Mutagenetix > Incidental Mutation

Incidental Mutation 'R2307:Ugt1a10'

244612

Institutional Source

Beutler Lab

Gene Symbol

Ugt1a10

Ensembl Gene

ENSMUSG00000090165

Gene Name

UDP glycosyltransferase 1 family, polypeptide A10

Synonyms

A13

MMRRC Submission

040306-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R2307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88055388-88219004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88055947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 156 (I156V)

Ref Sequence

ENSEMBL: ENSMUSP00000108767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113142] [ENSMUST00000138182] [ENSMUST00000173325]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113142
AA Change: I156V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165
AA Change: I156V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	521	7.3e-231	PFAM
Pfam:Glyco_tran_28_C	360	449	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138182

SMART Domains

Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	62	7e-11	PFAM
Pfam:UDPGT	58	207	1.9e-90	PFAM
Pfam:Glyco_tran_28_C	137	207	4.8e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173165

Predicted Effect

probably benign
Transcript: ENSMUST00000173325

SMART Domains

Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:UDPGT	26	61	3.4e-10	PFAM
Pfam:UDPGT	59	210	8.9e-92	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	C	12: 55,304,316	F137L	probably damaging	Het
Acot5	T	C	12: 84,075,601	F320L	possibly damaging	Het
Alox12e	T	C	11: 70,321,261	K170R	probably damaging	Het
Ano2	T	C	6: 125,992,886	S722P	probably benign	Het
Cep192	A	G	18: 67,813,899	Y215C	probably benign	Het
Ces2g	A	G	8: 104,968,412	N555S	probably benign	Het
Cfap58	C	T	19: 47,962,486	Q429*	probably null	Het
Clcnkb	A	G	4: 141,412,329	S121P	probably damaging	Het
Cltb	T	A	13: 54,598,751	E67D	probably damaging	Het
Ddhd1	A	T	14: 45,608,990	L581Q	probably damaging	Het
Dnajc3	T	C	14: 118,953,221		probably null	Het
Fgf14	T	A	14: 123,983,822	N190I	probably damaging	Het
Galnt17	T	G	5: 130,900,622	Y449S	probably damaging	Het
Grin3a	C	T	4: 49,793,033		probably null	Het
Gxylt2	A	G	6: 100,787,212	N286S	probably damaging	Het
H2-K1	A	G	17: 33,997,139	V120A	probably benign	Het
Inpp5f	T	C	7: 128,694,310	V168A	probably damaging	Het
Kif1a	G	T	1: 93,078,769	H59N	probably damaging	Het
Krt24	T	C	11: 99,284,630	Q193R	possibly damaging	Het
Krtap5-4	C	A	7: 142,303,614	S7*	probably null	Het
Ltn1	A	G	16: 87,432,424		probably null	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mep1b	A	T	18: 21,088,575	D194V	probably damaging	Het
Orc3	C	T	4: 34,586,503	V382M	probably damaging	Het
Pclo	T	A	5: 14,678,651		probably benign	Het
Pcolce	T	C	5: 137,609,094	H45R	probably damaging	Het
Prf1	T	C	10: 61,303,163	V300A	possibly damaging	Het
Prss53	T	C	7: 127,890,865	I18V	probably benign	Het
Rnase2b	A	G	14: 51,162,731	T90A	probably benign	Het
Rpap1	G	A	2: 119,783,766	P50L	probably benign	Het
Rrnad1	A	T	3: 87,926,855	M171K	possibly damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec16b	G	A	1: 157,535,492	V298I	probably damaging	Het
Smarcd3	C	T	5: 24,595,748	R156Q	probably damaging	Het
St6galnac2	C	T	11: 116,681,905	A242T	probably damaging	Het
Syce1l	T	C	8: 113,643,305		probably null	Het
Tcam1	T	C	11: 106,284,114	C132R	probably damaging	Het
Trpa1	T	C	1: 14,912,381	I84V	probably benign	Het
Ttn	G	A	2: 76,886,998	R455*	probably null	Het
Ubl5	T	A	9: 20,646,580		probably benign	Het
Ubr2	T	A	17: 46,966,215	K779*	probably null	Het
Unc13b	A	G	4: 43,239,854	T3513A	probably damaging	Het
Vmn1r20	C	T	6: 57,432,136	T149I	probably benign	Het
Zfp804a	T	A	2: 82,256,857	D343E	probably benign	Het

Other mutations in Ugt1a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Ugt1a10	APN	1	88055987	missense	possibly damaging	0.72
IGL02219:Ugt1a10	APN	1	88056058	missense	probably benign	0.00
IGL02511:Ugt1a10	APN	1	88055863	missense	probably damaging	1.00
IGL02990:Ugt1a10	APN	1	88055879	missense	probably damaging	1.00
PIT4142001:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R0201:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0201:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0522:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0525:Ugt1a10	UTSW	1	88218249	missense	probably damaging	1.00
R0554:Ugt1a10	UTSW	1	88056095	missense	probably damaging	1.00
R0748:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R0811:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R0812:Ugt1a10	UTSW	1	88056182	missense	probably benign	0.33
R1129:Ugt1a10	UTSW	1	88055609	missense	probably benign
R1207:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1432:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
R1457:Ugt1a10	UTSW	1	88055711	missense	probably damaging	1.00
R1469:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R1972:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R1973:Ugt1a10	UTSW	1	88056047	missense	probably damaging	1.00
R2039:Ugt1a10	UTSW	1	88055981	missense	probably benign	0.32
R3952:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R3973:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R4232:Ugt1a10	UTSW	1	88056210	missense	probably benign	0.39
R4392:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4393:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4402:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4417:Ugt1a10	UTSW	1	88055995	missense	probably benign
R4474:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4476:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4515:Ugt1a10	UTSW	1	88056197	missense	probably damaging	1.00
R4579:Ugt1a10	UTSW	1	88056116	missense	probably benign
R4582:Ugt1a10	UTSW	1	88055741	missense	possibly damaging	0.90
R4609:Ugt1a10	UTSW	1	88055482	start codon destroyed	possibly damaging	0.92
R4627:Ugt1a10	UTSW	1	88218390	missense	probably damaging	1.00
R4790:Ugt1a10	UTSW	1	88056287	missense	probably damaging	0.98
R4799:Ugt1a10	UTSW	1	88215928	intron	probably benign
R4910:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R4915:Ugt1a10	UTSW	1	88055924	missense	probably damaging	1.00
R5110:Ugt1a10	UTSW	1	88056252	splice site	probably null
R5168:Ugt1a10	UTSW	1	88055809	missense	probably benign	0.01
R5329:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
R5373:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5374:Ugt1a10	UTSW	1	88055910	missense	probably damaging	0.98
R5615:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
R6498:Ugt1a10	UTSW	1	88216140	missense	probably damaging	1.00
R6727:Ugt1a10	UTSW	1	88056257	splice site	probably null
R6809:Ugt1a10	UTSW	1	88055925	missense	probably damaging	0.98
R6924:Ugt1a10	UTSW	1	88055657	missense	probably damaging	0.99
R6967:Ugt1a10	UTSW	1	88215123	missense	probably damaging	1.00
R7913:Ugt1a10	UTSW	1	88055755	missense	probably benign	0.00
R9165:Ugt1a10	UTSW	1	88055787	missense	probably benign	0.00
R9264:Ugt1a10	UTSW	1	88055671	missense	possibly damaging	0.62
R9475:Ugt1a10	UTSW	1	88216260	missense	probably damaging	1.00
S24628:Ugt1a10	UTSW	1	88216158	small deletion	probably benign
X0013:Ugt1a10	UTSW	1	88216254	missense	probably damaging	1.00
Z1088:Ugt1a10	UTSW	1	88055842	missense	probably benign	0.20
Z1190:Ugt1a10	UTSW	1	88216158	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGACCTGGACAGAGAGTTC -3'
(R):5'- TTCAGAGGCAATTTCAACAGC -3'

Sequencing Primer
(F):5'- CTGGACAGAGAGTTCAAGTATTTTAC -3'
(R):5'- CAGAGGCAATTTCAACAGCAGTTTTG -3'

Posted On

2014-10-30