Incidental Mutation 'R2307:Smarcd3'
ID244625
Institutional Source Beutler Lab
Gene Symbol Smarcd3
Ensembl Gene ENSMUSG00000028949
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
SynonymsBAF60C, 1500001J14Rik, 2210409C08Rik
MMRRC Submission 040306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2307 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24590818-24624411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24595748 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 156 (R156Q)
Ref Sequence ENSEMBL: ENSMUSP00000143437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably damaging
Transcript: ENSMUST00000030791
AA Change: R185Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949
AA Change: R185Q

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably benign
Transcript: ENSMUST00000121863
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147857
Predicted Effect probably damaging
Transcript: ENSMUST00000195943
AA Change: R156Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949
AA Change: R156Q

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,316 F137L probably damaging Het
Acot5 T C 12: 84,075,601 F320L possibly damaging Het
Alox12e T C 11: 70,321,261 K170R probably damaging Het
Ano2 T C 6: 125,992,886 S722P probably benign Het
Cep192 A G 18: 67,813,899 Y215C probably benign Het
Ces2g A G 8: 104,968,412 N555S probably benign Het
Cfap58 C T 19: 47,962,486 Q429* probably null Het
Clcnkb A G 4: 141,412,329 S121P probably damaging Het
Cltb T A 13: 54,598,751 E67D probably damaging Het
Ddhd1 A T 14: 45,608,990 L581Q probably damaging Het
Dnajc3 T C 14: 118,953,221 probably null Het
Fgf14 T A 14: 123,983,822 N190I probably damaging Het
Galnt17 T G 5: 130,900,622 Y449S probably damaging Het
Grin3a C T 4: 49,793,033 probably null Het
Gxylt2 A G 6: 100,787,212 N286S probably damaging Het
H2-K1 A G 17: 33,997,139 V120A probably benign Het
Inpp5f T C 7: 128,694,310 V168A probably damaging Het
Kif1a G T 1: 93,078,769 H59N probably damaging Het
Krt24 T C 11: 99,284,630 Q193R possibly damaging Het
Krtap5-4 C A 7: 142,303,614 S7* probably null Het
Ltn1 A G 16: 87,432,424 probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mep1b A T 18: 21,088,575 D194V probably damaging Het
Orc3 C T 4: 34,586,503 V382M probably damaging Het
Pclo T A 5: 14,678,651 probably benign Het
Pcolce T C 5: 137,609,094 H45R probably damaging Het
Prf1 T C 10: 61,303,163 V300A possibly damaging Het
Prss53 T C 7: 127,890,865 I18V probably benign Het
Rnase2b A G 14: 51,162,731 T90A probably benign Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Rrnad1 A T 3: 87,926,855 M171K possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16b G A 1: 157,535,492 V298I probably damaging Het
St6galnac2 C T 11: 116,681,905 A242T probably damaging Het
Syce1l T C 8: 113,643,305 probably null Het
Tcam1 T C 11: 106,284,114 C132R probably damaging Het
Trpa1 T C 1: 14,912,381 I84V probably benign Het
Ttn G A 2: 76,886,998 R455* probably null Het
Ubl5 T A 9: 20,646,580 probably benign Het
Ubr2 T A 17: 46,966,215 K779* probably null Het
Ugt1a10 A G 1: 88,055,947 I156V probably benign Het
Unc13b A G 4: 43,239,854 T3513A probably damaging Het
Vmn1r20 C T 6: 57,432,136 T149I probably benign Het
Zfp804a T A 2: 82,256,857 D343E probably benign Het
Other mutations in Smarcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Smarcd3 APN 5 24593719 missense probably damaging 1.00
R0135:Smarcd3 UTSW 5 24595499 unclassified probably benign
R1614:Smarcd3 UTSW 5 24594876 missense possibly damaging 0.93
R1617:Smarcd3 UTSW 5 24595194 missense probably damaging 1.00
R1753:Smarcd3 UTSW 5 24595822 nonsense probably null
R1879:Smarcd3 UTSW 5 24593021 missense probably damaging 0.99
R3800:Smarcd3 UTSW 5 24593227 nonsense probably null
R4592:Smarcd3 UTSW 5 24592804 missense probably benign 0.00
R6369:Smarcd3 UTSW 5 24594984 missense probably damaging 0.99
R6388:Smarcd3 UTSW 5 24596026 missense possibly damaging 0.94
R7077:Smarcd3 UTSW 5 24594962 missense probably damaging 1.00
R7078:Smarcd3 UTSW 5 24593069 missense probably damaging 0.98
R7341:Smarcd3 UTSW 5 24595437 missense possibly damaging 0.95
R7426:Smarcd3 UTSW 5 24595812 missense probably benign 0.30
R7806:Smarcd3 UTSW 5 24593262 missense probably benign 0.45
RF007:Smarcd3 UTSW 5 24596070 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAGTAGTATACTCAGAGGCAGC -3'
(R):5'- CCCATGAAGGTGCCTTAGTG -3'

Sequencing Primer
(F):5'- AGCCCTCTGTCCCCAGAC -3'
(R):5'- CCTTAGTGTGGCAGTAGGGACAG -3'
Posted On2014-10-30