Incidental Mutation 'R2307:Fgf14'
ID244655
Institutional Source Beutler Lab
Gene Symbol Fgf14
Ensembl Gene ENSMUSG00000025551
Gene Namefibroblast growth factor 14
SynonymsFhf4
MMRRC Submission 040306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R2307 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123977907-124677127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123983822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 190 (N190I)
Ref Sequence ENSEMBL: ENSMUSP00000093185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000095529]
Predicted Effect probably damaging
Transcript: ENSMUST00000026631
AA Change: N185I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551
AA Change: N185I

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095529
AA Change: N190I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551
AA Change: N190I

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190088
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display impaired balance and grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,316 F137L probably damaging Het
Acot5 T C 12: 84,075,601 F320L possibly damaging Het
Alox12e T C 11: 70,321,261 K170R probably damaging Het
Ano2 T C 6: 125,992,886 S722P probably benign Het
Cep192 A G 18: 67,813,899 Y215C probably benign Het
Ces2g A G 8: 104,968,412 N555S probably benign Het
Cfap58 C T 19: 47,962,486 Q429* probably null Het
Clcnkb A G 4: 141,412,329 S121P probably damaging Het
Cltb T A 13: 54,598,751 E67D probably damaging Het
Ddhd1 A T 14: 45,608,990 L581Q probably damaging Het
Dnajc3 T C 14: 118,953,221 probably null Het
Galnt17 T G 5: 130,900,622 Y449S probably damaging Het
Grin3a C T 4: 49,793,033 probably null Het
Gxylt2 A G 6: 100,787,212 N286S probably damaging Het
H2-K1 A G 17: 33,997,139 V120A probably benign Het
Inpp5f T C 7: 128,694,310 V168A probably damaging Het
Kif1a G T 1: 93,078,769 H59N probably damaging Het
Krt24 T C 11: 99,284,630 Q193R possibly damaging Het
Krtap5-4 C A 7: 142,303,614 S7* probably null Het
Ltn1 A G 16: 87,432,424 probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mep1b A T 18: 21,088,575 D194V probably damaging Het
Orc3 C T 4: 34,586,503 V382M probably damaging Het
Pclo T A 5: 14,678,651 probably benign Het
Pcolce T C 5: 137,609,094 H45R probably damaging Het
Prf1 T C 10: 61,303,163 V300A possibly damaging Het
Prss53 T C 7: 127,890,865 I18V probably benign Het
Rnase2b A G 14: 51,162,731 T90A probably benign Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Rrnad1 A T 3: 87,926,855 M171K possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16b G A 1: 157,535,492 V298I probably damaging Het
Smarcd3 C T 5: 24,595,748 R156Q probably damaging Het
St6galnac2 C T 11: 116,681,905 A242T probably damaging Het
Syce1l T C 8: 113,643,305 probably null Het
Tcam1 T C 11: 106,284,114 C132R probably damaging Het
Trpa1 T C 1: 14,912,381 I84V probably benign Het
Ttn G A 2: 76,886,998 R455* probably null Het
Ubl5 T A 9: 20,646,580 probably benign Het
Ubr2 T A 17: 46,966,215 K779* probably null Het
Ugt1a10 A G 1: 88,055,947 I156V probably benign Het
Unc13b A G 4: 43,239,854 T3513A probably damaging Het
Vmn1r20 C T 6: 57,432,136 T149I probably benign Het
Zfp804a T A 2: 82,256,857 D343E probably benign Het
Other mutations in Fgf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Fgf14 APN 14 123980372 missense possibly damaging 0.51
IGL02733:Fgf14 APN 14 123983801 missense probably damaging 1.00
IGL02939:Fgf14 APN 14 124132479 missense possibly damaging 0.82
R0517:Fgf14 UTSW 14 123983784 missense probably damaging 1.00
R0608:Fgf14 UTSW 14 124676603 missense probably damaging 0.99
R1034:Fgf14 UTSW 14 124132534 missense probably damaging 0.96
R1183:Fgf14 UTSW 14 124676524 missense probably benign 0.03
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1584:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1768:Fgf14 UTSW 14 124676512 missense probably benign 0.00
R2190:Fgf14 UTSW 14 123983918 missense probably damaging 1.00
R3743:Fgf14 UTSW 14 124676620 missense probably benign
R3847:Fgf14 UTSW 14 123980389 missense probably benign 0.05
R4859:Fgf14 UTSW 14 124192433 missense possibly damaging 0.78
R5529:Fgf14 UTSW 14 123980455 missense probably damaging 1.00
R5655:Fgf14 UTSW 14 124192416 missense probably benign
R6242:Fgf14 UTSW 14 124676528 missense probably benign 0.02
R6958:Fgf14 UTSW 14 124676597 missense probably benign
R7460:Fgf14 UTSW 14 124676693 missense possibly damaging 0.92
R7726:Fgf14 UTSW 14 124136244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGTACACCACTCCAATAAAG -3'
(R):5'- TCCATGCAGACCAAGTGAAC -3'

Sequencing Primer
(F):5'- GAACATTTCTATCTGTCTCTGGAAGG -3'
(R):5'- GACCAAGTGAACACTGGAATCTTC -3'
Posted On2014-10-30