Incidental Mutation 'R2308:Ppfia4'
ID244665
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 040307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2308 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134332397 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 43 (S43P)
Ref Sequence ENSEMBL: ENSMUSP00000128314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000189361]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168515
AA Change: S43P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458
AA Change: S43P

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189361
AA Change: S43P

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458
AA Change: S43P

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dot1l T C 10: 80,789,069 S907P probably damaging Het
Epha7 G A 4: 28,821,503 E223K possibly damaging Het
Ercc6 T C 14: 32,566,409 I846T possibly damaging Het
Exoc4 A G 6: 33,918,568 Y840C probably damaging Het
Gramd1a T C 7: 31,139,790 D231G probably damaging Het
Mark2 A C 19: 7,281,934 S90A probably damaging Het
Mbd1 A G 18: 74,276,477 Q432R probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Met T C 6: 17,491,742 S168P probably benign Het
Nup210 T C 6: 91,040,868 I304V probably benign Het
Olfr1197 T A 2: 88,729,084 I172F probably damaging Het
Olfr356 T A 2: 36,937,300 Y60* probably null Het
Rbbp8 A T 18: 11,696,776 K132I possibly damaging Het
Rpap1 G A 2: 119,783,766 P50L probably benign Het
Slc41a3 T A 6: 90,612,120 I71K possibly damaging Het
Spaca7 A T 8: 12,598,959 N127I probably benign Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tbxas1 A G 6: 39,027,661 M281V probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Unc80 A T 1: 66,648,997 I2385F possibly damaging Het
Vmn2r118 A G 17: 55,624,650 I8T probably benign Het
Vmn2r80 T C 10: 79,171,621 F477S probably damaging Het
Ythdc2 A G 18: 44,847,748 E470G possibly damaging Het
Zfp352 A G 4: 90,225,243 K540R probably benign Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0849:Ppfia4 UTSW 1 134319372 missense probably benign 0.45
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2148:Ppfia4 UTSW 1 134312634 missense probably benign 0.25
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5727:Ppfia4 UTSW 1 134324077 critical splice donor site probably null
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6216:Ppfia4 UTSW 1 134329183 missense probably damaging 1.00
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
R8139:Ppfia4 UTSW 1 134300528 missense probably benign 0.01
Z1176:Ppfia4 UTSW 1 134327379 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCAGTATGTGATGTGCAAAGAG -3'
(R):5'- ACTGATGTCATGGGAGAAGCC -3'

Sequencing Primer
(F):5'- GATGCAGAGACTGAAGGGCC -3'
(R):5'- GCACTGCCTGTTCTGAGAC -3'
Posted On2014-10-30