Incidental Mutation 'R2308:Rpap1'
ID244669
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene NameRNA polymerase II associated protein 1
Synonyms
MMRRC Submission 040307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2308 (G1)
Quality Score171
Status Not validated
Chromosome2
Chromosomal Location119763304-119787537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119783766 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 50 (P50L)
Ref Sequence ENSEMBL: ENSMUSP00000138619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
Predicted Effect probably benign
Transcript: ENSMUST00000048493
AA Change: P50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: P50L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099529
AA Change: P50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: P50L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110793
AA Change: P50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: P50L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133146
Predicted Effect probably benign
Transcript: ENSMUST00000136419
AA Change: P50L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032
AA Change: P50L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156506
Predicted Effect probably benign
Transcript: ENSMUST00000184294
AA Change: P50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032
AA Change: P50L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dot1l T C 10: 80,789,069 S907P probably damaging Het
Epha7 G A 4: 28,821,503 E223K possibly damaging Het
Ercc6 T C 14: 32,566,409 I846T possibly damaging Het
Exoc4 A G 6: 33,918,568 Y840C probably damaging Het
Gramd1a T C 7: 31,139,790 D231G probably damaging Het
Mark2 A C 19: 7,281,934 S90A probably damaging Het
Mbd1 A G 18: 74,276,477 Q432R probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Met T C 6: 17,491,742 S168P probably benign Het
Nup210 T C 6: 91,040,868 I304V probably benign Het
Olfr1197 T A 2: 88,729,084 I172F probably damaging Het
Olfr356 T A 2: 36,937,300 Y60* probably null Het
Ppfia4 A G 1: 134,332,397 S43P possibly damaging Het
Rbbp8 A T 18: 11,696,776 K132I possibly damaging Het
Slc41a3 T A 6: 90,612,120 I71K possibly damaging Het
Spaca7 A T 8: 12,598,959 N127I probably benign Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tbxas1 A G 6: 39,027,661 M281V probably benign Het
Txnl1 T C 18: 63,671,620 T268A probably benign Het
Unc80 A T 1: 66,648,997 I2385F possibly damaging Het
Vmn2r118 A G 17: 55,624,650 I8T probably benign Het
Vmn2r80 T C 10: 79,171,621 F477S probably damaging Het
Ythdc2 A G 18: 44,847,748 E470G possibly damaging Het
Zfp352 A G 4: 90,225,243 K540R probably benign Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119782708 missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119780113 missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119782654 missense probably benign 0.02
IGL02100:Rpap1 APN 2 119769326 missense probably benign 0.06
IGL02528:Rpap1 APN 2 119774950 splice site probably null
IGL02530:Rpap1 APN 2 119783239 splice site probably benign
IGL02747:Rpap1 APN 2 119774128 missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119775057 splice site probably benign
R0138:Rpap1 UTSW 2 119764899 unclassified probably null
R0325:Rpap1 UTSW 2 119771840 missense probably benign
R0616:Rpap1 UTSW 2 119778120 missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119771269 missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119783778 missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119769885 critical splice donor site probably null
R2307:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2375:Rpap1 UTSW 2 119770407 missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R2508:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R4155:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119775006 missense probably benign 0.03
R4837:Rpap1 UTSW 2 119778251 missense probably benign 0.32
R4880:Rpap1 UTSW 2 119783865 missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119770041 missense probably benign
R5111:Rpap1 UTSW 2 119771247 missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119773850 missense probably benign
R6144:Rpap1 UTSW 2 119772647 nonsense probably null
R6353:Rpap1 UTSW 2 119776896 splice site probably null
R6646:Rpap1 UTSW 2 119780131 missense probably benign 0.03
R6731:Rpap1 UTSW 2 119778296 missense probably benign
R6872:Rpap1 UTSW 2 119775369 missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119778176 missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119773562 missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119771254 missense probably benign
R7640:Rpap1 UTSW 2 119764410 missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119775412 critical splice acceptor site probably null
R7945:Rpap1 UTSW 2 119775412 critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119764803 missense probably benign 0.13
X0028:Rpap1 UTSW 2 119771062 missense probably benign
Z1177:Rpap1 UTSW 2 119783752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTCTGGTCCCTCAGTAT -3'
(R):5'- GCATGGAAAAGATAAAGACCACC -3'

Sequencing Primer
(F):5'- CTGGTCCCTCAGTATTTACAAGAAG -3'
(R):5'- ACCAGGGTTCGGTTGTAACC -3'
Posted On2014-10-30