Incidental Mutation 'R0278:Trim5'
ID24467
Institutional Source Beutler Lab
Gene Symbol Trim5
Ensembl Gene ENSMUSG00000060441
Gene Nametripartite motif-containing 5
Synonyms
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104263386-104288094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104279675 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 20 (N20D)
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000098179]
Predicted Effect probably benign
Transcript: ENSMUST00000051795
AA Change: N20D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441
AA Change: N20D

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
AA Change: N20D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441
AA Change: N20D

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Trim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Trim5 APN 7 104279431 missense probably damaging 1.00
IGL02165:Trim5 APN 7 104279359 missense probably damaging 1.00
IGL02576:Trim5 APN 7 104278417 missense probably damaging 0.97
IGL02660:Trim5 APN 7 104266218 missense probably damaging 0.96
IGL02732:Trim5 APN 7 104278465 missense probably benign 0.02
R0373:Trim5 UTSW 7 104265684 missense probably benign 0.00
R0508:Trim5 UTSW 7 104265604 missense probably null 0.98
R0840:Trim5 UTSW 7 104265771 missense probably damaging 1.00
R0947:Trim5 UTSW 7 104265751 missense probably damaging 1.00
R1432:Trim5 UTSW 7 104279519 missense probably benign 0.04
R1432:Trim5 UTSW 7 104279521 missense probably benign
R1770:Trim5 UTSW 7 104276661 missense probably damaging 1.00
R1782:Trim5 UTSW 7 104265816 unclassified probably null
R1988:Trim5 UTSW 7 104265621 missense probably damaging 0.99
R2140:Trim5 UTSW 7 104276791 nonsense probably null
R3110:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3112:Trim5 UTSW 7 104279638 missense probably damaging 1.00
R3893:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R3948:Trim5 UTSW 7 104266520 nonsense probably null
R4114:Trim5 UTSW 7 104265740 missense probably damaging 0.99
R4249:Trim5 UTSW 7 104276815 missense possibly damaging 0.83
R4352:Trim5 UTSW 7 104276808 missense probably damaging 1.00
R4595:Trim5 UTSW 7 104265432 missense probably damaging 1.00
R5057:Trim5 UTSW 7 104265423 missense probably damaging 1.00
R5583:Trim5 UTSW 7 104276835 missense probably damaging 0.98
R5861:Trim5 UTSW 7 104279519 missense probably benign 0.04
R5861:Trim5 UTSW 7 104279521 missense probably benign
R7027:Trim5 UTSW 7 104265668 missense probably benign 0.00
R7078:Trim5 UTSW 7 104278474 missense possibly damaging 0.85
R7150:Trim5 UTSW 7 104276810 missense probably damaging 0.96
R7657:Trim5 UTSW 7 104276677 missense possibly damaging 0.51
R7660:Trim5 UTSW 7 104279362 missense probably damaging 1.00
R7737:Trim5 UTSW 7 104279564 missense probably damaging 1.00
R7821:Trim5 UTSW 7 104278426 missense probably benign 0.32
R7861:Trim5 UTSW 7 104266468 critical splice donor site probably null
R7944:Trim5 UTSW 7 104266468 critical splice donor site probably null
Z1088:Trim5 UTSW 7 104266225 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCGCTCACAAAGCCAGCAGATG -3'
(R):5'- agccagaaaatggaCTGACGTTCC -3'

Sequencing Primer
(F):5'- CCTACAGAAGAGCTGGAGTTTCTC -3'
(R):5'- aatggaCTGACGTTCCATTTCTTAC -3'
Posted On2013-04-16