Incidental Mutation 'R2308:Mcm2'
ID 244676
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
MMRRC Submission 040307-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2308 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88869990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 60 (R60C)
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: R204C

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: R204C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably damaging
Transcript: ENSMUST00000205165
AA Change: R60C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870
AA Change: R60C

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Depdc1b G A 13: 108,510,375 (GRCm39) V296I possibly damaging Het
Dot1l T C 10: 80,624,903 (GRCm39) S907P probably damaging Het
Epha7 G A 4: 28,821,503 (GRCm39) E223K possibly damaging Het
Ercc6 T C 14: 32,288,366 (GRCm39) I846T possibly damaging Het
Exoc4 A G 6: 33,895,503 (GRCm39) Y840C probably damaging Het
Gramd1a T C 7: 30,839,215 (GRCm39) D231G probably damaging Het
Mark2 A C 19: 7,259,299 (GRCm39) S90A probably damaging Het
Mbd1 A G 18: 74,409,548 (GRCm39) Q432R probably benign Het
Met T C 6: 17,491,741 (GRCm39) S168P probably benign Het
Nup210 T C 6: 91,017,850 (GRCm39) I304V probably benign Het
Or1ak2 T A 2: 36,827,312 (GRCm39) Y60* probably null Het
Or4a27 T A 2: 88,559,428 (GRCm39) I172F probably damaging Het
Ppfia4 A G 1: 134,260,135 (GRCm39) S43P possibly damaging Het
Rbbp8 A T 18: 11,829,833 (GRCm39) K132I possibly damaging Het
Rpap1 G A 2: 119,614,247 (GRCm39) P50L probably benign Het
Slc41a3 T A 6: 90,589,102 (GRCm39) I71K possibly damaging Het
Spaca7 A T 8: 12,648,959 (GRCm39) N127I probably benign Het
Stkld1 A T 2: 26,842,726 (GRCm39) D566V probably damaging Het
Tbxas1 A G 6: 39,004,595 (GRCm39) M281V probably benign Het
Txnl1 T C 18: 63,804,691 (GRCm39) T268A probably benign Het
Unc80 A T 1: 66,688,156 (GRCm39) I2385F possibly damaging Het
Vmn2r118 A G 17: 55,931,650 (GRCm39) I8T probably benign Het
Vmn2r80 T C 10: 79,007,455 (GRCm39) F477S probably damaging Het
Ythdc2 A G 18: 44,980,815 (GRCm39) E470G possibly damaging Het
Zfp352 A G 4: 90,113,480 (GRCm39) K540R probably benign Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88,866,891 (GRCm39) critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
R9745:Mcm2 UTSW 6 88,868,729 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAGTTCAGTGCGGCAC -3'
(R):5'- CTTTGCTACCCAAGACAGCAG -3'

Sequencing Primer
(F):5'- GCCAGCAGGATACAGAAGCC -3'
(R):5'- TACCCAAGACAGCAGCGAGG -3'
Posted On 2014-10-30