Incidental Mutation 'R2308:Mbd1'
ID 244691
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Name methyl-CpG binding domain protein 1
Synonyms PCM1, Cxxc3
MMRRC Submission 040307-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2308 (G1)
Quality Score 221
Status Not validated
Chromosome 18
Chromosomal Location 74400676-74415803 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74409548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 432 (Q432R)
Ref Sequence ENSEMBL: ENSMUSP00000153428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000097530
AA Change: Q376R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561
AA Change: Q376R

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224047
AA Change: Q432R

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224159
Predicted Effect probably benign
Transcript: ENSMUST00000224332
AA Change: Q266R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Depdc1b G A 13: 108,510,375 (GRCm39) V296I possibly damaging Het
Dot1l T C 10: 80,624,903 (GRCm39) S907P probably damaging Het
Epha7 G A 4: 28,821,503 (GRCm39) E223K possibly damaging Het
Ercc6 T C 14: 32,288,366 (GRCm39) I846T possibly damaging Het
Exoc4 A G 6: 33,895,503 (GRCm39) Y840C probably damaging Het
Gramd1a T C 7: 30,839,215 (GRCm39) D231G probably damaging Het
Mark2 A C 19: 7,259,299 (GRCm39) S90A probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Met T C 6: 17,491,741 (GRCm39) S168P probably benign Het
Nup210 T C 6: 91,017,850 (GRCm39) I304V probably benign Het
Or1ak2 T A 2: 36,827,312 (GRCm39) Y60* probably null Het
Or4a27 T A 2: 88,559,428 (GRCm39) I172F probably damaging Het
Ppfia4 A G 1: 134,260,135 (GRCm39) S43P possibly damaging Het
Rbbp8 A T 18: 11,829,833 (GRCm39) K132I possibly damaging Het
Rpap1 G A 2: 119,614,247 (GRCm39) P50L probably benign Het
Slc41a3 T A 6: 90,589,102 (GRCm39) I71K possibly damaging Het
Spaca7 A T 8: 12,648,959 (GRCm39) N127I probably benign Het
Stkld1 A T 2: 26,842,726 (GRCm39) D566V probably damaging Het
Tbxas1 A G 6: 39,004,595 (GRCm39) M281V probably benign Het
Txnl1 T C 18: 63,804,691 (GRCm39) T268A probably benign Het
Unc80 A T 1: 66,688,156 (GRCm39) I2385F possibly damaging Het
Vmn2r118 A G 17: 55,931,650 (GRCm39) I8T probably benign Het
Vmn2r80 T C 10: 79,007,455 (GRCm39) F477S probably damaging Het
Ythdc2 A G 18: 44,980,815 (GRCm39) E470G possibly damaging Het
Zfp352 A G 4: 90,113,480 (GRCm39) K540R probably benign Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74,408,310 (GRCm39) missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74,402,614 (GRCm39) unclassified probably benign
IGL02213:Mbd1 APN 18 74,408,453 (GRCm39) missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74,409,993 (GRCm39) missense probably benign 0.00
IGL02596:Mbd1 APN 18 74,409,868 (GRCm39) splice site probably benign
IGL02944:Mbd1 APN 18 74,410,481 (GRCm39) missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74,408,498 (GRCm39) splice site probably benign
IGL03200:Mbd1 APN 18 74,409,502 (GRCm39) missense probably benign 0.02
IGL03247:Mbd1 APN 18 74,407,825 (GRCm39) nonsense probably null
IGL03340:Mbd1 APN 18 74,407,553 (GRCm39) missense probably benign 0.00
Shortbread UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
FR4737:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
P0016:Mbd1 UTSW 18 74,407,609 (GRCm39) nonsense probably null
R0385:Mbd1 UTSW 18 74,406,312 (GRCm39) frame shift probably null
R0630:Mbd1 UTSW 18 74,409,798 (GRCm39) splice site probably benign
R0717:Mbd1 UTSW 18 74,406,668 (GRCm39) missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74,402,603 (GRCm39) missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74,402,557 (GRCm39) missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74,408,490 (GRCm39) critical splice donor site probably null
R2065:Mbd1 UTSW 18 74,409,955 (GRCm39) missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74,410,449 (GRCm39) missense probably damaging 0.99
R2697:Mbd1 UTSW 18 74,406,688 (GRCm39) missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74,410,438 (GRCm39) missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74,407,487 (GRCm39) missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74,402,597 (GRCm39) missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74,402,581 (GRCm39) missense probably benign 0.03
R5860:Mbd1 UTSW 18 74,409,768 (GRCm39) nonsense probably null
R6431:Mbd1 UTSW 18 74,406,762 (GRCm39) splice site probably null
R6734:Mbd1 UTSW 18 74,409,114 (GRCm39) missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74,406,645 (GRCm39)
R7363:Mbd1 UTSW 18 74,406,357 (GRCm39) missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74,407,520 (GRCm39) missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74,407,804 (GRCm39) missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74,407,128 (GRCm39) critical splice donor site probably null
R8960:Mbd1 UTSW 18 74,406,890 (GRCm39) critical splice donor site probably null
R9161:Mbd1 UTSW 18 74,407,792 (GRCm39) missense probably benign 0.01
R9774:Mbd1 UTSW 18 74,408,274 (GRCm39) missense probably benign
RF005:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF011:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,681 (GRCm39) small deletion probably benign
RF024:Mbd1 UTSW 18 74,406,644 (GRCm39) small deletion probably benign
RF058:Mbd1 UTSW 18 74,406,680 (GRCm39) frame shift probably null
Z1177:Mbd1 UTSW 18 74,410,010 (GRCm39) missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- TCTGATGGGAAGTTAGCAGGC -3'
(R):5'- GTACTGGGACTTCTGTGCAAGC -3'

Sequencing Primer
(F):5'- AGGCTCACTGAGTAGGGC -3'
(R):5'- GCTGGTACCCTCTTGTAAAAAC -3'
Posted On 2014-10-30