Incidental Mutation 'R2309:Sgpp2'
ID244694
Institutional Source Beutler Lab
Gene Symbol Sgpp2
Ensembl Gene ENSMUSG00000032908
Gene Namesphingosine-1-phosphate phosphotase 2
Synonyms
MMRRC Submission 040308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2309 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78310345-78420289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78417349 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 330 (F330L)
Ref Sequence ENSEMBL: ENSMUSP00000036656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036172] [ENSMUST00000170217]
Predicted Effect probably damaging
Transcript: ENSMUST00000036172
AA Change: F330L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036656
Gene: ENSMUSG00000032908
AA Change: F330L

DomainStartEndE-ValueType
acidPPc 74 188 7.56e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 271 293 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170217
SMART Domains Protein: ENSMUSP00000129828
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein that degrades the bioactive signaling molecule sphingosine 1-phosphate. The encoded protein is induced during inflammatory responses and has been shown to be downregulated by the microRNA-31 tumor suppressor. Alternative splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pancreatic beta cell endoplasmic reticulum stress under basal conditions and decreased adaptive beta cell proliferation in response to treatment with either a high-fat diet or the beta cell-specific toxin, streptozotocin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G T 6: 86,096,801 C224F probably damaging Het
Ankhd1 A G 18: 36,624,765 I837M probably damaging Het
Baat T C 4: 49,499,718 Y196C probably damaging Het
Cd19 T C 7: 126,414,275 N114S probably benign Het
Cldn24 T G 8: 47,822,739 Y199* probably null Het
Il1rl1 A G 1: 40,442,657 D175G possibly damaging Het
Kcnh8 T A 17: 52,978,039 D1012E probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Med23 T G 10: 24,870,688 D35E probably damaging Het
Nbeal2 T C 9: 110,626,570 D2512G probably damaging Het
Nfatc4 A T 14: 55,827,004 D246V probably damaging Het
Nlrp9c C A 7: 26,378,087 V757F probably damaging Het
Olfr1120 T C 2: 87,357,954 F170S probably damaging Het
Pcnt T A 10: 76,442,626 probably benign Het
Qsox2 T C 2: 26,228,433 I109V possibly damaging Het
Rnf17 A G 14: 56,505,982 K1335R possibly damaging Het
Serpina6 A G 12: 103,654,179 Y104H probably benign Het
Serpini2 A G 3: 75,259,690 S87P probably damaging Het
Setx G A 2: 29,158,904 V1981M probably damaging Het
Slc6a6 G C 6: 91,726,196 W183C possibly damaging Het
Ttll9 A G 2: 152,984,145 K81E probably damaging Het
Ulbp1 G A 10: 7,447,388 T239I probably benign Het
Vmn1r230 A G 17: 20,847,230 H227R probably damaging Het
Wdr17 A T 8: 54,643,248 F1029I probably benign Het
Other mutations in Sgpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sgpp2 APN 1 78390547 missense probably benign 0.00
IGL01646:Sgpp2 APN 1 78416896 missense probably damaging 0.98
IGL02797:Sgpp2 APN 1 78417182 missense probably benign
IGL03329:Sgpp2 APN 1 78390563 missense probably benign
R2024:Sgpp2 UTSW 1 78417220 missense probably benign 0.06
R2056:Sgpp2 UTSW 1 78416951 missense probably damaging 0.99
R2059:Sgpp2 UTSW 1 78416951 missense probably damaging 0.99
R2570:Sgpp2 UTSW 1 78360150 missense possibly damaging 0.80
R5342:Sgpp2 UTSW 1 78360188 missense probably benign 0.00
R6209:Sgpp2 UTSW 1 78390482 missense probably damaging 1.00
R6645:Sgpp2 UTSW 1 78360162 missense probably damaging 1.00
R8186:Sgpp2 UTSW 1 78416972 missense probably benign 0.00
Z1176:Sgpp2 UTSW 1 78417365 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCACTGACATGCTGGTTTTAG -3'
(R):5'- TGTCCTTACAGGTGAATCCCAC -3'

Sequencing Primer
(F):5'- ACATGCTGGTTTTAGGTCTGACC -3'
(R):5'- CAGCAGCCGTATCTATGTTACATCAG -3'
Posted On2014-10-30