Incidental Mutation 'R2309:Ttll9'
ID244699
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission 040308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2309 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152984145 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 81 (K81E)
Ref Sequence ENSEMBL: ENSMUSP00000114786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000155631] [ENSMUST00000165343]
Predicted Effect probably damaging
Transcript: ENSMUST00000099197
AA Change: K92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: K92E

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103155
AA Change: K92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: K92E

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109801
AA Change: K92E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673
AA Change: K92E

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect probably benign
Transcript: ENSMUST00000152158
AA Change: E110G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably damaging
Transcript: ENSMUST00000155631
AA Change: K81E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114786
Gene: ENSMUSG00000074673
AA Change: K81E

DomainStartEndE-ValueType
Pfam:TTL 57 139 3.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G T 6: 86,096,801 C224F probably damaging Het
Ankhd1 A G 18: 36,624,765 I837M probably damaging Het
Baat T C 4: 49,499,718 Y196C probably damaging Het
Cd19 T C 7: 126,414,275 N114S probably benign Het
Cldn24 T G 8: 47,822,739 Y199* probably null Het
Il1rl1 A G 1: 40,442,657 D175G possibly damaging Het
Kcnh8 T A 17: 52,978,039 D1012E probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Med23 T G 10: 24,870,688 D35E probably damaging Het
Nbeal2 T C 9: 110,626,570 D2512G probably damaging Het
Nfatc4 A T 14: 55,827,004 D246V probably damaging Het
Nlrp9c C A 7: 26,378,087 V757F probably damaging Het
Olfr1120 T C 2: 87,357,954 F170S probably damaging Het
Pcnt T A 10: 76,442,626 probably benign Het
Qsox2 T C 2: 26,228,433 I109V possibly damaging Het
Rnf17 A G 14: 56,505,982 K1335R possibly damaging Het
Serpina6 A G 12: 103,654,179 Y104H probably benign Het
Serpini2 A G 3: 75,259,690 S87P probably damaging Het
Setx G A 2: 29,158,904 V1981M probably damaging Het
Sgpp2 T C 1: 78,417,349 F330L probably damaging Het
Slc6a6 G C 6: 91,726,196 W183C possibly damaging Het
Ulbp1 G A 10: 7,447,388 T239I probably benign Het
Vmn1r230 A G 17: 20,847,230 H227R probably damaging Het
Wdr17 A T 8: 54,643,248 F1029I probably benign Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152962487 unclassified probably benign
BB011:Ttll9 UTSW 2 152962487 unclassified probably benign
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7924:Ttll9 UTSW 2 152962487 unclassified probably benign
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152994148 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTGCTGAGGACAAAAGGTC -3'
(R):5'- TGATACTGGGCCTTCCTGAG -3'

Sequencing Primer
(F):5'- TCAGAAAGGGGGTCATCGTGTC -3'
(R):5'- CTCACAGGCTTCATGATCCAGG -3'
Posted On2014-10-30