Incidental Mutation 'R2309:Cldn24'
ID244707
Institutional Source Beutler Lab
Gene Symbol Cldn24
Ensembl Gene ENSMUSG00000061974
Gene Nameclaudin 24
SynonymsGm10107
MMRRC Submission 040308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2309 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location47822143-47822805 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 47822739 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 199 (Y199*)
Ref Sequence ENSEMBL: ENSMUSP00000078584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038693] [ENSMUST00000057561] [ENSMUST00000079639]
Predicted Effect probably benign
Transcript: ENSMUST00000038693
SMART Domains Protein: ENSMUSP00000041676
Gene: ENSMUSG00000038064

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 6.2e-23 PFAM
Pfam:Claudin_2 18 184 1.8e-9 PFAM
low complexity region 185 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057561
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079639
AA Change: Y199*
SMART Domains Protein: ENSMUSP00000078584
Gene: ENSMUSG00000061974
AA Change: Y199*

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 9.1e-25 PFAM
Pfam:Claudin_2 18 184 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212295
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is 75% identical to the human homolog. Similar to the human gene, this gene is upstream of the Cldn22 gene, which overlaps the Wwc2 gene on the opposite strand. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G T 6: 86,096,801 C224F probably damaging Het
Ankhd1 A G 18: 36,624,765 I837M probably damaging Het
Baat T C 4: 49,499,718 Y196C probably damaging Het
Cd19 T C 7: 126,414,275 N114S probably benign Het
Il1rl1 A G 1: 40,442,657 D175G possibly damaging Het
Kcnh8 T A 17: 52,978,039 D1012E probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Med23 T G 10: 24,870,688 D35E probably damaging Het
Nbeal2 T C 9: 110,626,570 D2512G probably damaging Het
Nfatc4 A T 14: 55,827,004 D246V probably damaging Het
Nlrp9c C A 7: 26,378,087 V757F probably damaging Het
Olfr1120 T C 2: 87,357,954 F170S probably damaging Het
Pcnt T A 10: 76,442,626 probably benign Het
Qsox2 T C 2: 26,228,433 I109V possibly damaging Het
Rnf17 A G 14: 56,505,982 K1335R possibly damaging Het
Serpina6 A G 12: 103,654,179 Y104H probably benign Het
Serpini2 A G 3: 75,259,690 S87P probably damaging Het
Setx G A 2: 29,158,904 V1981M probably damaging Het
Sgpp2 T C 1: 78,417,349 F330L probably damaging Het
Slc6a6 G C 6: 91,726,196 W183C possibly damaging Het
Ttll9 A G 2: 152,984,145 K81E probably damaging Het
Ulbp1 G A 10: 7,447,388 T239I probably benign Het
Vmn1r230 A G 17: 20,847,230 H227R probably damaging Het
Wdr17 A T 8: 54,643,248 F1029I probably benign Het
Other mutations in Cldn24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2252:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2253:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R6265:Cldn24 UTSW 8 47822339 missense probably benign 0.00
R6818:Cldn24 UTSW 8 47822722 missense probably benign 0.03
R7688:Cldn24 UTSW 8 47822705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCATGGTGCTAGTTCC -3'
(R):5'- TTGGACAATCCCCAGCATAC -3'

Sequencing Primer
(F):5'- AGTCATGGTGCTAGTTCCTGTCTC -3'
(R):5'- TTTCCACACATAGCTATGCAATG -3'
Posted On2014-10-30