Mutagenetix > Incidental Mutations

Incidental Mutation 'R2309:Med23'

244711

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

040308-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2309 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 24870688 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 35 (D35E)

Ref Sequence

ENSEMBL: ENSMUSP00000134866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176313] [ENSMUST00000177232]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020159
AA Change: D35E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: D35E

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092646
AA Change: D35E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: D35E

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176313
AA Change: D8E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135751
Gene: ENSMUSG00000019984
AA Change: D8E

Domain	Start	End	E-Value	Type
Pfam:Med23	1	197	1.7e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177175

Predicted Effect

probably damaging
Transcript: ENSMUST00000177232
AA Change: D35E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984
AA Change: D35E

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177522

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add2	G	T	6: 86,096,801	C224F	probably damaging	Het
Ankhd1	A	G	18: 36,624,765	I837M	probably damaging	Het
Baat	T	C	4: 49,499,718	Y196C	probably damaging	Het
Cd19	T	C	7: 126,414,275	N114S	probably benign	Het
Cldn24	T	G	8: 47,822,739	Y199*	probably null	Het
Il1rl1	A	G	1: 40,442,657	D175G	possibly damaging	Het
Kcnh8	T	A	17: 52,978,039	D1012E	probably damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nbeal2	T	C	9: 110,626,570	D2512G	probably damaging	Het
Nfatc4	A	T	14: 55,827,004	D246V	probably damaging	Het
Nlrp9c	C	A	7: 26,378,087	V757F	probably damaging	Het
Olfr1120	T	C	2: 87,357,954	F170S	probably damaging	Het
Pcnt	T	A	10: 76,442,626		probably benign	Het
Qsox2	T	C	2: 26,228,433	I109V	possibly damaging	Het
Rnf17	A	G	14: 56,505,982	K1335R	possibly damaging	Het
Serpina6	A	G	12: 103,654,179	Y104H	probably benign	Het
Serpini2	A	G	3: 75,259,690	S87P	probably damaging	Het
Setx	G	A	2: 29,158,904	V1981M	probably damaging	Het
Sgpp2	T	C	1: 78,417,349	F330L	probably damaging	Het
Slc6a6	G	C	6: 91,726,196	W183C	possibly damaging	Het
Ttll9	A	G	2: 152,984,145	K81E	probably damaging	Het
Ulbp1	G	A	10: 7,447,388	T239I	probably benign	Het
Vmn1r230	A	G	17: 20,847,230	H227R	probably damaging	Het
Wdr17	A	T	8: 54,643,248	F1029I	probably benign	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R4943:Med23	UTSW	10	24875669	missense	possibly damaging	0.92
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTATGTGGCAGGCAGATC -3'
(R):5'- ACACAGGTTCTCCAGTAAGTAC -3'

Sequencing Primer
(F):5'- ATGTGGCAGGCAGATCTTTGTG -3'
(R):5'- CAGGTTCTCCAGTAAGTACATTTAC -3'

Posted On

2014-10-30