Incidental Mutation 'R2309:Nfatc4'
ID 244715
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms 3110041H08Rik
MMRRC Submission 040308-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2309 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56062252-56071400 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56064461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 246 (D246V)
Ref Sequence ENSEMBL: ENSMUSP00000154682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357] [ENSMUST00000226979]
AlphaFold Q8K120
Predicted Effect probably damaging
Transcript: ENSMUST00000024179
AA Change: D316V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: D316V

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172271
AA Change: D316V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: D316V

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226293
Predicted Effect probably damaging
Transcript: ENSMUST00000226357
AA Change: D246V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227746
Predicted Effect probably benign
Transcript: ENSMUST00000228308
Predicted Effect probably benign
Transcript: ENSMUST00000226979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226869
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G T 6: 86,073,783 (GRCm39) C224F probably damaging Het
Ankhd1 A G 18: 36,757,818 (GRCm39) I837M probably damaging Het
Baat T C 4: 49,499,718 (GRCm39) Y196C probably damaging Het
Cd19 T C 7: 126,013,447 (GRCm39) N114S probably benign Het
Cldn24 T G 8: 48,275,774 (GRCm39) Y199* probably null Het
Il1rl1 A G 1: 40,481,817 (GRCm39) D175G possibly damaging Het
Kcnh8 T A 17: 53,285,067 (GRCm39) D1012E probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Med23 T G 10: 24,746,586 (GRCm39) D35E probably damaging Het
Nbeal2 T C 9: 110,455,638 (GRCm39) D2512G probably damaging Het
Nlrp9c C A 7: 26,077,512 (GRCm39) V757F probably damaging Het
Or12e8 T C 2: 87,188,298 (GRCm39) F170S probably damaging Het
Pcnt T A 10: 76,278,460 (GRCm39) probably benign Het
Qsox2 T C 2: 26,118,445 (GRCm39) I109V possibly damaging Het
Rnf17 A G 14: 56,743,439 (GRCm39) K1335R possibly damaging Het
Serpina6 A G 12: 103,620,438 (GRCm39) Y104H probably benign Het
Serpini2 A G 3: 75,166,997 (GRCm39) S87P probably damaging Het
Setx G A 2: 29,048,916 (GRCm39) V1981M probably damaging Het
Sgpp2 T C 1: 78,393,986 (GRCm39) F330L probably damaging Het
Slc6a6 G C 6: 91,703,177 (GRCm39) W183C possibly damaging Het
Ttll9 A G 2: 152,826,065 (GRCm39) K81E probably damaging Het
Ulbp1 G A 10: 7,397,388 (GRCm39) T239I probably benign Het
Vmn1r230 A G 17: 21,067,492 (GRCm39) H227R probably damaging Het
Wdr17 A T 8: 55,096,283 (GRCm39) F1029I probably benign Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 56,070,019 (GRCm39) missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 56,069,962 (GRCm39) missense probably benign 0.03
IGL01791:Nfatc4 APN 14 56,069,695 (GRCm39) missense probably null 0.04
IGL02536:Nfatc4 APN 14 56,067,367 (GRCm39) missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 56,069,111 (GRCm39) missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 56,067,485 (GRCm39) missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 56,064,101 (GRCm39) missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 56,064,101 (GRCm39) missense probably damaging 1.00
R0965:Nfatc4 UTSW 14 56,064,043 (GRCm39) missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 56,070,088 (GRCm39) missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 56,070,291 (GRCm39) unclassified probably benign
R4200:Nfatc4 UTSW 14 56,069,489 (GRCm39) missense probably damaging 1.00
R4905:Nfatc4 UTSW 14 56,068,039 (GRCm39) missense probably benign 0.16
R5067:Nfatc4 UTSW 14 56,069,875 (GRCm39) missense probably damaging 0.98
R5202:Nfatc4 UTSW 14 56,064,116 (GRCm39) missense probably damaging 1.00
R5415:Nfatc4 UTSW 14 56,070,091 (GRCm39) missense probably benign
R5585:Nfatc4 UTSW 14 56,064,212 (GRCm39) missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 56,069,733 (GRCm39) missense probably benign 0.02
R6030:Nfatc4 UTSW 14 56,069,897 (GRCm39) nonsense probably null
R6030:Nfatc4 UTSW 14 56,069,897 (GRCm39) nonsense probably null
R6172:Nfatc4 UTSW 14 56,066,990 (GRCm39) missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 56,062,512 (GRCm39) missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 56,069,421 (GRCm39) missense probably benign 0.19
R7738:Nfatc4 UTSW 14 56,069,414 (GRCm39) missense possibly damaging 0.83
R8309:Nfatc4 UTSW 14 56,063,848 (GRCm39) missense probably damaging 0.99
R8445:Nfatc4 UTSW 14 56,063,875 (GRCm39) missense possibly damaging 0.85
R8853:Nfatc4 UTSW 14 56,063,690 (GRCm39) missense probably damaging 0.98
R9177:Nfatc4 UTSW 14 56,064,685 (GRCm39) missense probably damaging 1.00
R9268:Nfatc4 UTSW 14 56,064,685 (GRCm39) missense probably damaging 1.00
R9553:Nfatc4 UTSW 14 56,070,259 (GRCm39) missense probably damaging 1.00
R9667:Nfatc4 UTSW 14 56,066,964 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGGATAGCTGGCTACTCCTCAG -3'
(R):5'- ACTGCTAGGTAATCCATGCC -3'

Sequencing Primer
(F):5'- GGCTACTCCTCAGCGCTC -3'
(R):5'- TAGGTAATCCATGCCGGCCAC -3'
Posted On 2014-10-30