Incidental Mutation 'R2309:Rnf17'
ID 244716
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Name ring finger protein 17
Synonyms MMIP-2
MMRRC Submission 040308-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.522) question?
Stock # R2309 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 56640107-56762489 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56743439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1335 (K1335R)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
AlphaFold Q99MV7
Predicted Effect possibly damaging
Transcript: ENSMUST00000095793
AA Change: K1335R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: K1335R

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225737
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G T 6: 86,073,783 (GRCm39) C224F probably damaging Het
Ankhd1 A G 18: 36,757,818 (GRCm39) I837M probably damaging Het
Baat T C 4: 49,499,718 (GRCm39) Y196C probably damaging Het
Cd19 T C 7: 126,013,447 (GRCm39) N114S probably benign Het
Cldn24 T G 8: 48,275,774 (GRCm39) Y199* probably null Het
Il1rl1 A G 1: 40,481,817 (GRCm39) D175G possibly damaging Het
Kcnh8 T A 17: 53,285,067 (GRCm39) D1012E probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Med23 T G 10: 24,746,586 (GRCm39) D35E probably damaging Het
Nbeal2 T C 9: 110,455,638 (GRCm39) D2512G probably damaging Het
Nfatc4 A T 14: 56,064,461 (GRCm39) D246V probably damaging Het
Nlrp9c C A 7: 26,077,512 (GRCm39) V757F probably damaging Het
Or12e8 T C 2: 87,188,298 (GRCm39) F170S probably damaging Het
Pcnt T A 10: 76,278,460 (GRCm39) probably benign Het
Qsox2 T C 2: 26,118,445 (GRCm39) I109V possibly damaging Het
Serpina6 A G 12: 103,620,438 (GRCm39) Y104H probably benign Het
Serpini2 A G 3: 75,166,997 (GRCm39) S87P probably damaging Het
Setx G A 2: 29,048,916 (GRCm39) V1981M probably damaging Het
Sgpp2 T C 1: 78,393,986 (GRCm39) F330L probably damaging Het
Slc6a6 G C 6: 91,703,177 (GRCm39) W183C possibly damaging Het
Ttll9 A G 2: 152,826,065 (GRCm39) K81E probably damaging Het
Ulbp1 G A 10: 7,397,388 (GRCm39) T239I probably benign Het
Vmn1r230 A G 17: 21,067,492 (GRCm39) H227R probably damaging Het
Wdr17 A T 8: 55,096,283 (GRCm39) F1029I probably benign Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56,658,539 (GRCm39) missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56,703,207 (GRCm39) missense probably benign 0.00
IGL00978:Rnf17 APN 14 56,749,728 (GRCm39) missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56,700,521 (GRCm39) nonsense probably null
IGL01779:Rnf17 APN 14 56,699,520 (GRCm39) missense probably benign 0.06
IGL02132:Rnf17 APN 14 56,658,623 (GRCm39) missense probably benign 0.27
IGL02183:Rnf17 APN 14 56,745,325 (GRCm39) missense probably null 0.99
IGL02387:Rnf17 APN 14 56,738,044 (GRCm39) missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56,719,592 (GRCm39) missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56,671,828 (GRCm39) missense probably benign 0.03
IGL03269:Rnf17 APN 14 56,665,403 (GRCm39) missense possibly damaging 0.74
divest UTSW 14 56,661,999 (GRCm39) frame shift probably null
Shed UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56,708,830 (GRCm39) missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56,708,830 (GRCm39) missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56,751,563 (GRCm39) missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56,719,650 (GRCm39) missense probably null 1.00
R0243:Rnf17 UTSW 14 56,719,541 (GRCm39) missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56,676,066 (GRCm39) missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56,751,632 (GRCm39) missense probably benign 0.43
R0554:Rnf17 UTSW 14 56,760,007 (GRCm39) missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56,712,904 (GRCm39) missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56,751,622 (GRCm39) missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56,663,088 (GRCm39) missense probably benign 0.10
R1200:Rnf17 UTSW 14 56,705,163 (GRCm39) missense probably benign 0.44
R1464:Rnf17 UTSW 14 56,699,368 (GRCm39) missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56,699,368 (GRCm39) missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56,665,436 (GRCm39) missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56,705,243 (GRCm39) missense probably benign 0.01
R1605:Rnf17 UTSW 14 56,730,822 (GRCm39) missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56,759,856 (GRCm39) missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56,741,464 (GRCm39) nonsense probably null
R2015:Rnf17 UTSW 14 56,724,426 (GRCm39) missense probably benign 0.00
R2023:Rnf17 UTSW 14 56,669,036 (GRCm39) missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56,720,837 (GRCm39) missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56,730,811 (GRCm39) missense probably damaging 1.00
R3003:Rnf17 UTSW 14 56,738,004 (GRCm39) missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56,705,197 (GRCm39) missense probably benign 0.43
R3847:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56,712,870 (GRCm39) missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56,712,870 (GRCm39) missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56,697,458 (GRCm39) missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56,697,458 (GRCm39) missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56,671,812 (GRCm39) missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56,759,848 (GRCm39) missense probably benign 0.02
R5068:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56,719,590 (GRCm39) missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56,724,409 (GRCm39) splice site probably null
R5712:Rnf17 UTSW 14 56,708,856 (GRCm39) missense probably benign 0.19
R5747:Rnf17 UTSW 14 56,703,276 (GRCm39) critical splice donor site probably null
R5869:Rnf17 UTSW 14 56,743,445 (GRCm39) missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56,658,626 (GRCm39) splice site probably null
R6626:Rnf17 UTSW 14 56,665,381 (GRCm39) missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56,676,200 (GRCm39) missense probably benign 0.01
R6675:Rnf17 UTSW 14 56,697,432 (GRCm39) missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56,761,807 (GRCm39) missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56,703,111 (GRCm39) missense probably benign 0.00
R7103:Rnf17 UTSW 14 56,708,763 (GRCm39) missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56,749,789 (GRCm39) splice site probably null
R7527:Rnf17 UTSW 14 56,753,895 (GRCm39) missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56,676,335 (GRCm39) missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56,699,529 (GRCm39) critical splice donor site probably null
R7772:Rnf17 UTSW 14 56,715,144 (GRCm39) missense probably benign 0.27
R8092:Rnf17 UTSW 14 56,724,479 (GRCm39) missense probably benign 0.00
R8150:Rnf17 UTSW 14 56,658,593 (GRCm39) missense probably benign 0.19
R8203:Rnf17 UTSW 14 56,705,179 (GRCm39) missense probably benign 0.17
R8320:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8321:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8379:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8380:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8381:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8382:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8383:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8799:Rnf17 UTSW 14 56,737,886 (GRCm39) missense probably damaging 1.00
R8850:Rnf17 UTSW 14 56,722,658 (GRCm39) missense probably damaging 1.00
R9212:Rnf17 UTSW 14 56,761,785 (GRCm39) missense probably damaging 1.00
R9276:Rnf17 UTSW 14 56,719,554 (GRCm39) missense probably damaging 1.00
R9300:Rnf17 UTSW 14 56,697,495 (GRCm39) missense possibly damaging 0.79
R9375:Rnf17 UTSW 14 56,719,579 (GRCm39) missense probably damaging 1.00
R9664:Rnf17 UTSW 14 56,722,636 (GRCm39) missense probably damaging 1.00
Z1177:Rnf17 UTSW 14 56,705,163 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATTTCTGTTGACTGCCCATGGTAC -3'
(R):5'- TGAAATGTCTCAGCAACTTGC -3'

Sequencing Primer
(F):5'- CATGGTACTCATGTGCATTTAGTTC -3'
(R):5'- GCAACTTGCTCAAAATTAGGCTTGC -3'
Posted On 2014-10-30