Incidental Mutation 'R2310:Efhd1'
ID244722
Institutional Source Beutler Lab
Gene Symbol Efhd1
Ensembl Gene ENSMUSG00000026255
Gene NameEF hand domain containing 1
Synonyms4931430I01Rik, PP3051, mitocalcin
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87264363-87310839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87264628 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 60 (L60P)
Ref Sequence ENSEMBL: ENSMUSP00000112980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027472] [ENSMUST00000118687]
Predicted Effect probably damaging
Transcript: ENSMUST00000027472
AA Change: L60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027472
Gene: ENSMUSG00000026255
AA Change: L60P

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
EFh 95 123 1.11e-3 SMART
EFh 131 159 2.64e-1 SMART
coiled coil region 203 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118687
AA Change: L60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112980
Gene: ENSMUSG00000026255
AA Change: L60P

DomainStartEndE-ValueType
low complexity region 34 52 N/A INTRINSIC
EFh 95 123 1.11e-3 SMART
EFh 131 159 2.64e-1 SMART
coiled coil region 203 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138844
Meta Mutation Damage Score 0.1270 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EF-hand super family of calcium binding proteins, which are involved in a variety of cellular processes including mitosis, synaptic transmission, and cytoskeletal rearrangement. The protein encoded by this gene is composed of an N-terminal disordered region, proline-rich elements, two EF-hands, and a C-terminal coiled-coil domain. This protein has been shown to associate with the mitochondrial inner membrane, and in HeLa cells, acts as a novel mitochondrial calcium ion sensor for mitochondrial flash activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Efhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:Efhd1 APN 1 87264612 missense probably damaging 1.00
IGL03062:Efhd1 APN 1 87264684 missense possibly damaging 0.55
R1673:Efhd1 UTSW 1 87264682 missense probably damaging 0.99
R2163:Efhd1 UTSW 1 87289473 missense probably damaging 1.00
R2566:Efhd1 UTSW 1 87309755 missense possibly damaging 0.72
R4996:Efhd1 UTSW 1 87264558 missense possibly damaging 0.95
R5508:Efhd1 UTSW 1 87309794 makesense probably null
R7090:Efhd1 UTSW 1 87289497 missense probably damaging 0.96
R8065:Efhd1 UTSW 1 87264591 missense probably benign 0.01
R8067:Efhd1 UTSW 1 87264591 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAGCGCACAACTCTCTG -3'
(R):5'- AACTTGATGCGCACGATCTG -3'

Sequencing Primer
(F):5'- TACCGGATCGCGAACCTCAG -3'
(R):5'- ACTTGGCCAGATGCTCAGTG -3'
Posted On2014-10-30