Incidental Mutation 'R2310:Rassf5'
ID244723
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene NameRas association (RalGDS/AF-6) domain family member 5
SynonymsNore1A, Nore1B, Rapl, 1300019G20Rik
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2310 (G1)
Quality Score113
Status Validated
Chromosome1
Chromosomal Location131176410-131245258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131244740 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 131 (W131R)
Ref Sequence ENSEMBL: ENSMUSP00000108061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000112442]
Predicted Effect probably damaging
Transcript: ENSMUST00000027688
AA Change: W131R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: W131R

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112442
AA Change: W131R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430
AA Change: W131R

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124796
Meta Mutation Damage Score 0.3312 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131180599 missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131244995 missense probably benign 0.00
R0464:Rassf5 UTSW 1 131212261 missense probably benign 0.00
R0589:Rassf5 UTSW 1 131244983 missense probably damaging 0.99
R0634:Rassf5 UTSW 1 131244956 missense probably damaging 0.99
R0639:Rassf5 UTSW 1 131245066 missense probably damaging 1.00
R0727:Rassf5 UTSW 1 131181265 missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131212339 missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131180648 missense probably benign 0.00
R5422:Rassf5 UTSW 1 131181174 missense possibly damaging 0.87
R5490:Rassf5 UTSW 1 131181195 missense possibly damaging 0.95
R6189:Rassf5 UTSW 1 131244979 missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131180668 missense probably damaging 1.00
R6531:Rassf5 UTSW 1 131244814 missense possibly damaging 0.93
R6759:Rassf5 UTSW 1 131182251 missense probably benign 0.08
R7115:Rassf5 UTSW 1 131181249 missense probably benign 0.21
R7350:Rassf5 UTSW 1 131178536 missense possibly damaging 0.75
R7910:Rassf5 UTSW 1 131180629 missense probably benign 0.15
R8286:Rassf5 UTSW 1 131212330 missense possibly damaging 0.73
Z1176:Rassf5 UTSW 1 131182217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGCTGTCTCCAAAG -3'
(R):5'- TTTAAAAGCGCGCTCGACC -3'

Sequencing Primer
(F):5'- GCTGTCTCCAAAGGTAACCTG -3'
(R):5'- CGCGGTATCTGCAGAGTCTG -3'
Posted On2014-10-30