Incidental Mutation 'R2310:Trmt6'
ID244727
Institutional Source Beutler Lab
Gene Symbol Trmt6
Ensembl Gene ENSMUSG00000037376
Gene NametRNA methyltransferase 6
Synonyms3300001M20Rik
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132804207-132816055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132808912 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 259 (P259T)
Ref Sequence ENSEMBL: ENSMUSP00000044687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039554]
Predicted Effect probably damaging
Transcript: ENSMUST00000039554
AA Change: P259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044687
Gene: ENSMUSG00000037376
AA Change: P259T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Gcd10p 20 302 7.2e-74 PFAM
coiled coil region 345 364 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152836
Meta Mutation Damage Score 0.8137 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tRNA methyltransferase 6 protein family. A similar protein in yeast is part of a two component methyltransferase, which is involved in the posttranslational modification that produces the modified nucleoside 1-methyladenosine in tRNAs. Modified 1-methyladenosine influences initiator methionine stability and may be involved in the replication of human immunodeficiency virus type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Trmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Trmt6 APN 2 132805458 missense probably benign 0.01
IGL02604:Trmt6 APN 2 132810437 nonsense probably null
IGL03216:Trmt6 APN 2 132808698 missense probably null
IGL03231:Trmt6 APN 2 132815836 missense probably benign 0.01
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0086:Trmt6 UTSW 2 132809017 critical splice acceptor site probably benign
R0485:Trmt6 UTSW 2 132809030 splice site probably benign
R0827:Trmt6 UTSW 2 132815834 missense probably damaging 1.00
R1654:Trmt6 UTSW 2 132815835 missense possibly damaging 0.92
R1757:Trmt6 UTSW 2 132810237 missense probably damaging 0.96
R1974:Trmt6 UTSW 2 132811048 missense probably damaging 1.00
R2008:Trmt6 UTSW 2 132806909 nonsense probably null
R4989:Trmt6 UTSW 2 132808271 missense possibly damaging 0.58
R5288:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5385:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5386:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R6546:Trmt6 UTSW 2 132812153 missense probably benign 0.16
R6815:Trmt6 UTSW 2 132809858 missense probably damaging 1.00
R8016:Trmt6 UTSW 2 132809906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGGAACAATCTCCATTGG -3'
(R):5'- TCTCCACCCTGTAGACATGG -3'

Sequencing Primer
(F):5'- AACAATCTCCATTGGTCTCTGTTC -3'
(R):5'- AACCGTGTGAGGACTTGGGC -3'
Posted On2014-10-30