Incidental Mutation 'R2310:Ubap1'
ID244730
Institutional Source Beutler Lab
Gene Symbol Ubap1
Ensembl Gene ENSMUSG00000028437
Gene Nameubiquitin-associated protein 1
SynonymsNAG20, 2700092A01Rik
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41348996-41390525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41379341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 185 (V185E)
Ref Sequence ENSEMBL: ENSMUSP00000103695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072866] [ENSMUST00000108060]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072866
AA Change: V185E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072643
Gene: ENSMUSG00000028437
AA Change: V185E

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
SCOP:d1ifya_ 387 430 5e-10 SMART
PDB:4AE4|B 388 502 1e-74 PDB
Blast:UBA 392 428 7e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000108060
AA Change: V185E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103695
Gene: ENSMUSG00000028437
AA Change: V185E

DomainStartEndE-ValueType
coiled coil region 64 95 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
PDB:4AE4|B 362 441 2e-50 PDB
SCOP:d1exja1 394 437 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132235
SMART Domains Protein: ENSMUSP00000123491
Gene: ENSMUSG00000028437

DomainStartEndE-ValueType
SCOP:d1ifya_ 68 111 2e-11 SMART
PDB:4AE4|B 69 140 2e-44 PDB
Blast:UBA 73 109 7e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154529
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the UBA domain family, whose members include proteins having connections to ubiquitin and the ubiquitination pathway. The ubiquitin associated domain is thought to be a non-covalent ubiquitin binding domain consisting of a compact three helix bundle. This particular protein originates from a gene locus in a refined region on chromosome 9 undergoing loss of heterozygosity in nasopharyngeal carcinoma (NPC). Taking into account its cytogenetic location, this UBA domain family member is being studies as a putative target for mutation in nasopharyngeal carcinomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Ubap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ubap1 APN 4 41379562 missense probably benign
IGL01413:Ubap1 APN 4 41387333 missense probably benign 0.04
IGL01418:Ubap1 APN 4 41387333 missense probably benign 0.04
IGL01867:Ubap1 APN 4 41379236 missense probably benign 0.00
IGL02535:Ubap1 APN 4 41379667 nonsense probably null
R0090:Ubap1 UTSW 4 41379826 missense probably damaging 0.98
R0980:Ubap1 UTSW 4 41379832 missense probably damaging 1.00
R1941:Ubap1 UTSW 4 41378968 missense probably damaging 0.96
R2049:Ubap1 UTSW 4 41379257 missense probably damaging 1.00
R2142:Ubap1 UTSW 4 41379257 missense probably damaging 1.00
R3508:Ubap1 UTSW 4 41379163 missense probably damaging 1.00
R4118:Ubap1 UTSW 4 41371767 missense probably damaging 1.00
R4375:Ubap1 UTSW 4 41371850 critical splice donor site probably null
R5053:Ubap1 UTSW 4 41387315 nonsense probably null
R5121:Ubap1 UTSW 4 41379688 missense probably benign
R6137:Ubap1 UTSW 4 41379262 missense possibly damaging 0.60
R6820:Ubap1 UTSW 4 41379854 missense probably benign 0.00
R7393:Ubap1 UTSW 4 41379764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATCCTTGCCAGCTTACAG -3'
(R):5'- ACACTTTGGAAGACAGCGAC -3'

Sequencing Primer
(F):5'- GCTTACAGCACAACAACATCCTC -3'
(R):5'- GGAAGACAGCGACATCTTTTC -3'
Posted On2014-10-30