Incidental Mutation 'R2310:Pramef12'
ID244733
Institutional Source Beutler Lab
Gene Symbol Pramef12
Ensembl Gene ENSMUSG00000028591
Gene NamePRAME family member 12
Synonyms4930569K13Rik
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144391674-144408464 bp(-) (GRCm38)
Type of Mutationunclassified (2151 bp from exon)
DNA Base Change (assembly) A to T at 144392905 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030326] [ENSMUST00000123854]
Predicted Effect probably benign
Transcript: ENSMUST00000030326
AA Change: M364K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030326
Gene: ENSMUSG00000028591
AA Change: M364K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 414 7e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123854
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Pramef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef12 APN 4 144394740 missense possibly damaging 0.91
IGL01107:Pramef12 APN 4 144393094 missense probably benign 0.00
IGL01935:Pramef12 APN 4 144392602 unclassified probably benign
IGL02436:Pramef12 APN 4 144392969 missense possibly damaging 0.95
IGL02491:Pramef12 APN 4 144394752 missense probably damaging 1.00
IGL02744:Pramef12 APN 4 144392923 missense probably damaging 1.00
IGL03338:Pramef12 APN 4 144394827 missense probably benign 0.01
R0005:Pramef12 UTSW 4 144395853 missense probably damaging 1.00
R1401:Pramef12 UTSW 4 144395088 missense probably benign 0.00
R1611:Pramef12 UTSW 4 144392812 missense probably benign 0.20
R1667:Pramef12 UTSW 4 144393036 nonsense probably null
R2017:Pramef12 UTSW 4 144394674 missense possibly damaging 0.49
R2290:Pramef12 UTSW 4 144394699 missense probably benign 0.00
R2290:Pramef12 UTSW 4 144395122 missense probably benign 0.19
R2912:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R2913:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R4558:Pramef12 UTSW 4 144395972 start codon destroyed probably null 1.00
R5162:Pramef12 UTSW 4 144394912 missense probably damaging 0.96
R5521:Pramef12 UTSW 4 144395971 start codon destroyed probably null 1.00
R5530:Pramef12 UTSW 4 144392662 missense probably benign 0.03
R5669:Pramef12 UTSW 4 144395843 missense probably benign 0.03
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6314:Pramef12 UTSW 4 144394587 missense probably damaging 0.98
R6322:Pramef12 UTSW 4 144392905 missense probably benign 0.09
R6431:Pramef12 UTSW 4 144393083 missense possibly damaging 0.83
R7729:Pramef12 UTSW 4 144392864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCAAGGGGTAGAATACATCTC -3'
(R):5'- ACTTGGTCCTTCCCTAGGTG -3'

Sequencing Primer
(F):5'- TCCAAGCTTAAATAGTTCAGCCCG -3'
(R):5'- AGGTCCCCTTGGAGATCCTC -3'
Posted On2014-10-30