Incidental Mutation 'R2310:Mrpl19'
ID244739
Institutional Source Beutler Lab
Gene Symbol Mrpl19
Ensembl Gene ENSMUSG00000030045
Gene Namemitochondrial ribosomal protein L19
SynonymsRpml15, D6Ertd157e, 9030416F12Rik, RLX1, MRP-L15
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location81957851-81965958 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 81964073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032124] [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably null
Transcript: ENSMUST00000032124
SMART Domains Protein: ENSMUSP00000032124
Gene: ENSMUSG00000030045

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Ribosomal_L19 92 198 9e-19 PFAM
SCOP:d1fura_ 214 282 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043195
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148025
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Mrpl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL00563:Mrpl19 APN 6 81965872 missense probably benign 0.02
IGL02113:Mrpl19 APN 6 81965915 missense probably benign
IGL02116:Mrpl19 APN 6 81965777 missense probably benign 0.41
IGL02256:Mrpl19 APN 6 81964319 missense probably benign 0.06
IGL02347:Mrpl19 APN 6 81962011 missense probably damaging 0.99
IGL02415:Mrpl19 APN 6 81963961 missense probably benign 0.29
IGL02825:Mrpl19 APN 6 81965815 missense probably benign 0.25
IGL03189:Mrpl19 APN 6 81961993 nonsense probably null
R1824:Mrpl19 UTSW 6 81964079 splice site probably null
R3176:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3276:Mrpl19 UTSW 6 81964066 missense probably damaging 0.99
R3821:Mrpl19 UTSW 6 81962006 nonsense probably null
R4705:Mrpl19 UTSW 6 81964285 missense probably damaging 0.99
R4736:Mrpl19 UTSW 6 81964348 missense probably damaging 1.00
R5464:Mrpl19 UTSW 6 81962011 missense probably damaging 0.99
R7408:Mrpl19 UTSW 6 81965812 missense possibly damaging 0.65
R7835:Mrpl19 UTSW 6 81962126 missense probably damaging 1.00
R7918:Mrpl19 UTSW 6 81962126 missense probably damaging 1.00
Z1177:Mrpl19 UTSW 6 81964310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAAGCACACATTATCTCTTGG -3'
(R):5'- TGCTTCCGATTCCAGAGTTC -3'

Sequencing Primer
(F):5'- GCACACATTATCTCTTGGGGAAATCC -3'
(R):5'- CCAGAGTTCTATGTTGGTGAGTAAC -3'
Posted On2014-10-30