Incidental Mutation 'R2310:Kif23'
ID244744
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Namekinesin family member 23
SynonymsMKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location61915905-61946774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61924144 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 715 (S715P)
Ref Sequence ENSEMBL: ENSMUSP00000034815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]
Predicted Effect probably damaging
Transcript: ENSMUST00000034815
AA Change: S715P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: S715P

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213595
Predicted Effect probably benign
Transcript: ENSMUST00000214295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216812
Meta Mutation Damage Score 0.1225 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61926468 missense probably benign 0.19
IGL00814:Kif23 APN 9 61937107 missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61932129 missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61919900 missense probably damaging 0.99
IGL01583:Kif23 APN 9 61935468 missense probably damaging 1.00
IGL01680:Kif23 APN 9 61931814 missense probably benign 0.17
IGL02450:Kif23 APN 9 61923957 missense probably benign 0.00
IGL02698:Kif23 APN 9 61925001 missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61929776 splice site probably benign
IGL03233:Kif23 APN 9 61926453 missense probably benign 0.05
H8562:Kif23 UTSW 9 61924065 missense probably benign
R0225:Kif23 UTSW 9 61925694 splice site probably benign
R0419:Kif23 UTSW 9 61926405 nonsense probably null
R0512:Kif23 UTSW 9 61918975 splice site probably benign
R0731:Kif23 UTSW 9 61925032 missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61936764 missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61923988 unclassified probably null
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1347:Kif23 UTSW 9 61927156 missense probably damaging 0.99
R1451:Kif23 UTSW 9 61924802 missense probably damaging 1.00
R1624:Kif23 UTSW 9 61925700 splice site probably null
R1820:Kif23 UTSW 9 61926438 missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61918961 missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61946610 critical splice donor site probably null
R2001:Kif23 UTSW 9 61927384 nonsense probably null
R2002:Kif23 UTSW 9 61927384 nonsense probably null
R2680:Kif23 UTSW 9 61937476 missense probably benign 0.25
R3196:Kif23 UTSW 9 61931911 nonsense probably null
R3774:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3775:Kif23 UTSW 9 61924992 missense probably benign 0.00
R3776:Kif23 UTSW 9 61924992 missense probably benign 0.00
R4349:Kif23 UTSW 9 61932114 missense probably damaging 1.00
R4671:Kif23 UTSW 9 61945359 missense probably benign 0.04
R4981:Kif23 UTSW 9 61931871 missense probably damaging 1.00
R4983:Kif23 UTSW 9 61936703 missense probably benign 0.01
R5685:Kif23 UTSW 9 61945409 missense probably benign 0.12
R5721:Kif23 UTSW 9 61944216 missense probably benign 0.45
R6903:Kif23 UTSW 9 61927154 missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61924989 missense probably benign 0.01
R7103:Kif23 UTSW 9 61919892 missense probably damaging 0.99
R7456:Kif23 UTSW 9 61937120 missense probably benign 0.09
R7468:Kif23 UTSW 9 61937175 nonsense probably null
Z1177:Kif23 UTSW 9 61924163 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCCTTCAGTCCAGCACATG -3'
(R):5'- GAACGTTTCTCCGTGAGAATTG -3'

Sequencing Primer
(F):5'- TCAGTCCAGCACATGCCTCG -3'
(R):5'- GTGCCTTAAATCCCAGCATTAGGG -3'
Posted On2014-10-30