Incidental Mutation 'R2310:Pip5k1c'
ID244747
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
SynonymsPIP5KIgamma
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81292963-81319973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 81306308 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 117 (S117R)
Ref Sequence ENSEMBL: ENSMUSP00000038225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000163075]
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: S117R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: S117R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105327
AA Change: S117R

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: S117R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161719
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163009
Predicted Effect probably benign
Transcript: ENSMUST00000163075
AA Change: S117R

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: S117R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81312515 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81305186 missense probably benign 0.40
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81310817 missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81308960 missense probably damaging 1.00
R8218:Pip5k1c UTSW 10 81306416 missense probably damaging 1.00
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AAAATTCGGTGGCAAGGTGTTG -3'
(R):5'- GTACAGCTCTCGTTTTCAGGC -3'

Sequencing Primer
(F):5'- CCCATGCCCATGTGTATTCGAG -3'
(R):5'- CTTCAGCCTGGGGAAGCTTG -3'
Posted On2014-10-30