Incidental Mutation 'R2310:Gas2l2'
ID244749
Institutional Source Beutler Lab
Gene Symbol Gas2l2
Ensembl Gene ENSMUSG00000020686
Gene Namegrowth arrest-specific 2 like 2
SynonymsOTTMUSG00000000934
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83421902-83429455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83427439 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000051907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052521] [ENSMUST00000147301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052521
AA Change: V148A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147301
AA Change: V148A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686
AA Change: V148A

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to crosslink microtubules and microfilaments and may be part of the cytoskeleton. This gene is mainly expressed in skeletal muscle. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Gas2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01860:Gas2l2 APN 11 83422080 missense probably benign 0.05
IGL02304:Gas2l2 APN 11 83424238 unclassified probably benign
IGL02672:Gas2l2 APN 11 83425131 missense probably damaging 1.00
IGL02695:Gas2l2 APN 11 83422642 missense probably damaging 1.00
IGL03375:Gas2l2 APN 11 83426210 splice site probably benign
R0046:Gas2l2 UTSW 11 83421910 missense probably damaging 1.00
R0046:Gas2l2 UTSW 11 83421910 missense probably damaging 1.00
R0081:Gas2l2 UTSW 11 83422867 missense possibly damaging 0.95
R0183:Gas2l2 UTSW 11 83429056 missense probably benign 0.36
R0383:Gas2l2 UTSW 11 83423097 missense probably benign 0.06
R1157:Gas2l2 UTSW 11 83423328 missense probably benign 0.00
R1439:Gas2l2 UTSW 11 83427472 missense probably damaging 1.00
R1453:Gas2l2 UTSW 11 83422081 missense probably benign 0.02
R2071:Gas2l2 UTSW 11 83421949 missense probably benign
R2085:Gas2l2 UTSW 11 83427383 missense probably benign
R4619:Gas2l2 UTSW 11 83423098 missense probably benign 0.01
R4620:Gas2l2 UTSW 11 83423098 missense probably benign 0.01
R4655:Gas2l2 UTSW 11 83423175 missense possibly damaging 0.92
R4755:Gas2l2 UTSW 11 83429367 missense probably damaging 0.99
R4897:Gas2l2 UTSW 11 83429215 missense probably damaging 1.00
R6466:Gas2l2 UTSW 11 83429353 missense probably damaging 1.00
R6705:Gas2l2 UTSW 11 83422636 nonsense probably null
R7074:Gas2l2 UTSW 11 83423067 missense probably benign 0.14
R7179:Gas2l2 UTSW 11 83422462 missense probably benign 0.09
R7343:Gas2l2 UTSW 11 83421990 nonsense probably null
R7554:Gas2l2 UTSW 11 83424410 nonsense probably null
R7748:Gas2l2 UTSW 11 83422398 missense probably benign 0.00
R7772:Gas2l2 UTSW 11 83429277 missense possibly damaging 0.79
R7869:Gas2l2 UTSW 11 83421990 nonsense probably null
R7952:Gas2l2 UTSW 11 83421990 nonsense probably null
X0021:Gas2l2 UTSW 11 83427440 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGTAGCGGCTGTTACATGTG -3'
(R):5'- AACCTGAGATGCTGAGACCC -3'

Sequencing Primer
(F):5'- AGGCAGGGCACATGTTC -3'
(R):5'- AGATGCTGAGACCCGAGCC -3'
Posted On2014-10-30