Incidental Mutation 'R0278:Ddx6'
Institutional Source Beutler Lab
Gene Symbol Ddx6
Ensembl Gene ENSMUSG00000032097
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 6
SynonymsmRCK/P54, HLR2, rck, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosomal Location44604892-44640731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44631425 bp
Amino Acid Change Cysteine to Glycine at position 385 (C385G)
Ref Sequence ENSEMBL: ENSMUSP00000149620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170489] [ENSMUST00000217034]
Predicted Effect probably damaging
Transcript: ENSMUST00000170489
AA Change: C385G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128421
Gene: ENSMUSG00000032097
AA Change: C385G

low complexity region 30 41 N/A INTRINSIC
Blast:DEXDc 42 88 7e-18 BLAST
DEXDc 115 312 3.67e-52 SMART
HELICc 348 429 1.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213697
Predicted Effect probably damaging
Transcript: ENSMUST00000217034
AA Change: C385G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217540
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Ddx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02561:Ddx6 APN 9 44634168 missense probably damaging 0.96
IGL02880:Ddx6 APN 9 44612897 splice site probably benign
R1330:Ddx6 UTSW 9 44627773 splice site probably benign
R2001:Ddx6 UTSW 9 44607534 missense probably benign
R2002:Ddx6 UTSW 9 44607534 missense probably benign
R2124:Ddx6 UTSW 9 44624519 nonsense probably null
R2177:Ddx6 UTSW 9 44627731 missense probably damaging 1.00
R2347:Ddx6 UTSW 9 44607591 missense probably benign 0.00
R2863:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R2865:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R4584:Ddx6 UTSW 9 44624487 missense probably damaging 1.00
R4915:Ddx6 UTSW 9 44612873 missense probably damaging 1.00
R5476:Ddx6 UTSW 9 44607456 missense possibly damaging 0.67
R6213:Ddx6 UTSW 9 44628693 missense probably damaging 0.99
R6264:Ddx6 UTSW 9 44628752 missense probably damaging 1.00
R6368:Ddx6 UTSW 9 44635776 missense probably damaging 1.00
R6525:Ddx6 UTSW 9 44623629 missense probably damaging 1.00
R6994:Ddx6 UTSW 9 44628723 missense probably damaging 0.98
R7252:Ddx6 UTSW 9 44623753 splice site probably null
R7463:Ddx6 UTSW 9 44628729 missense probably damaging 1.00
R7706:Ddx6 UTSW 9 44627642 missense probably damaging 1.00
R7752:Ddx6 UTSW 9 44627663 missense probably damaging 1.00
R7784:Ddx6 UTSW 9 44630142 critical splice donor site probably null
RF004:Ddx6 UTSW 9 44624492 missense possibly damaging 0.76
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggcttattatgcctgtcctttttg -3'
Posted On2013-04-16