Incidental Mutation 'R2310:Golga5'
ID244753
Institutional Source Beutler Lab
Gene Symbol Golga5
Ensembl Gene ENSMUSG00000021192
Gene Namegolgi autoantigen, golgin subfamily a, 5
SynonymsRet-II
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102469135-102497907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102492161 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 621 (E621G)
Ref Sequence ENSEMBL: ENSMUSP00000137305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021609] [ENSMUST00000179218]
Predicted Effect probably damaging
Transcript: ENSMUST00000021609
AA Change: E621G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021609
Gene: ENSMUSG00000021192
AA Change: E621G

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179218
AA Change: E621G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137305
Gene: ENSMUSG00000021192
AA Change: E621G

DomainStartEndE-ValueType
low complexity region 148 167 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
Pfam:Golgin_A5 233 709 1.1e-172 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000222744
AA Change: E165G
Meta Mutation Damage Score 0.2219 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein is a coiled-coil membrane protein that has been postulated to play a role in vesicle tethering and docking. Translocations involving this gene and the ret proto-oncogene have been found in tumor tissues; the chimeric sequences have been designated RET-II and PTC5. A pseudogene of this gene is located on the short arm of chromosome 5. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout does not result in an obvious phenotype and does not affect Golgi apparatus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Golga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Golga5 APN 12 102493814 missense probably damaging 0.99
IGL01487:Golga5 APN 12 102495696 intron probably benign
IGL01585:Golga5 APN 12 102479695 missense probably benign
IGL01901:Golga5 APN 12 102479802 critical splice donor site probably null
IGL02063:Golga5 APN 12 102472159 missense probably benign 0.00
IGL02118:Golga5 APN 12 102495752 missense possibly damaging 0.67
IGL02568:Golga5 APN 12 102472079 missense probably benign 0.33
FR4976:Golga5 UTSW 12 102475660 intron probably null
R0244:Golga5 UTSW 12 102476188 missense probably benign
R0432:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R0552:Golga5 UTSW 12 102484493 missense possibly damaging 0.75
R0659:Golga5 UTSW 12 102476208 missense possibly damaging 0.50
R1244:Golga5 UTSW 12 102472295 missense probably benign 0.01
R1542:Golga5 UTSW 12 102474720 missense probably damaging 1.00
R1791:Golga5 UTSW 12 102492131 missense possibly damaging 0.48
R5110:Golga5 UTSW 12 102472077 missense probably benign 0.02
R5704:Golga5 UTSW 12 102489448 missense probably benign 0.00
R6228:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6229:Golga5 UTSW 12 102484481 missense probably benign 0.00
R6241:Golga5 UTSW 12 102472473 missense probably damaging 0.96
R7236:Golga5 UTSW 12 102474775 critical splice donor site probably null
R7355:Golga5 UTSW 12 102472235 missense possibly damaging 0.83
R7404:Golga5 UTSW 12 102484519 missense probably damaging 0.97
R7493:Golga5 UTSW 12 102484576 critical splice donor site probably null
R8062:Golga5 UTSW 12 102484480 missense probably benign
R8231:Golga5 UTSW 12 102472299 missense probably benign
Z1177:Golga5 UTSW 12 102472005 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTCAAGGACCCAATTCATGAC -3'
(R):5'- TTACACTGGAAGAAGAAGCACC -3'

Sequencing Primer
(F):5'- AGAGCCTGTGTACTGATTCAGTGAAC -3'
(R):5'- GAAGCACCAGAGAAAGTTTCTTTTC -3'
Posted On2014-10-30