Incidental Mutation 'R2310:Slc45a4'
ID244757
Institutional Source Beutler Lab
Gene Symbol Slc45a4
Ensembl Gene ENSMUSG00000079020
Gene Namesolute carrier family 45, member 4
Synonyms9330175B01Rik
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73577424-73645762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73589560 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 87 (Y87H)
Ref Sequence ENSEMBL: ENSMUSP00000121775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054266] [ENSMUST00000076224] [ENSMUST00000132607] [ENSMUST00000151288]
Predicted Effect probably damaging
Transcript: ENSMUST00000054266
AA Change: Y87H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054651
Gene: ENSMUSG00000079020
AA Change: Y87H

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
transmembrane domain 585 604 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 685 707 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
low complexity region 754 770 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076224
AA Change: Y87H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075577
Gene: ENSMUSG00000079020
AA Change: Y87H

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132607
SMART Domains Protein: ENSMUSP00000115827
Gene: ENSMUSG00000079020

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
low complexity region 286 297 N/A INTRINSIC
low complexity region 299 316 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
transmembrane domain 383 402 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 483 505 N/A INTRINSIC
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144936
AA Change: Y14H
SMART Domains Protein: ENSMUSP00000122825
Gene: ENSMUSG00000079020
AA Change: Y14H

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
transmembrane domain 461 483 N/A INTRINSIC
transmembrane domain 513 532 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
transmembrane domain 571 593 N/A INTRINSIC
transmembrane domain 613 635 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 682 698 N/A INTRINSIC
low complexity region 703 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151288
AA Change: Y87H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121775
Gene: ENSMUSG00000079020
AA Change: Y87H

DomainStartEndE-ValueType
Pfam:MFS_2 52 266 1.6e-9 PFAM
low complexity region 480 491 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
transmembrane domain 577 596 N/A INTRINSIC
transmembrane domain 609 631 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
transmembrane domain 677 699 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
low complexity region 746 762 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152558
SMART Domains Protein: ENSMUSP00000114790
Gene: ENSMUSG00000079020

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 112 131 N/A INTRINSIC
Meta Mutation Damage Score 0.2042 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Sptbn2 A G 19: 4,718,935 D32G probably benign Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Slc45a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Slc45a4 APN 15 73587655 missense probably damaging 1.00
IGL02506:Slc45a4 APN 15 73581838 missense probably benign 0.00
IGL02642:Slc45a4 APN 15 73586815 missense probably benign
IGL03195:Slc45a4 APN 15 73584423 missense possibly damaging 0.89
Undefined UTSW 15 73584450 missense probably damaging 1.00
R0048:Slc45a4 UTSW 15 73605436 splice site probably benign
R0189:Slc45a4 UTSW 15 73581914 missense probably benign 0.00
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0240:Slc45a4 UTSW 15 73581906 missense probably benign 0.02
R0828:Slc45a4 UTSW 15 73586816 missense probably benign 0.01
R1172:Slc45a4 UTSW 15 73605429 splice site probably benign
R1331:Slc45a4 UTSW 15 73586747 missense probably benign 0.00
R1739:Slc45a4 UTSW 15 73586038 missense probably damaging 1.00
R4695:Slc45a4 UTSW 15 73582075 missense possibly damaging 0.94
R4904:Slc45a4 UTSW 15 73586842 missense probably benign 0.18
R4974:Slc45a4 UTSW 15 73584450 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6033:Slc45a4 UTSW 15 73581976 missense probably damaging 1.00
R6114:Slc45a4 UTSW 15 73605604 missense probably damaging 0.96
R7057:Slc45a4 UTSW 15 73587638 missense probably damaging 1.00
R7221:Slc45a4 UTSW 15 73586410 missense probably benign 0.06
R7288:Slc45a4 UTSW 15 73586936 nonsense probably null
R7331:Slc45a4 UTSW 15 73605640 missense probably benign 0.02
R7874:Slc45a4 UTSW 15 73584335 splice site probably null
R7901:Slc45a4 UTSW 15 73605772 start gained probably benign
R7957:Slc45a4 UTSW 15 73584335 splice site probably null
R7984:Slc45a4 UTSW 15 73605772 start gained probably benign
R8003:Slc45a4 UTSW 15 73585313 nonsense probably null
R8188:Slc45a4 UTSW 15 73584534 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GTGAAGTCACCAGATAAGGCCC -3'
(R):5'- TAGTGGTCCTTCAGGCAGAG -3'

Sequencing Primer
(F):5'- ACACTCACCTATGGCGGAG -3'
(R):5'- CCCTTAGGGGAAAGATGT -3'
Posted On2014-10-30