Mutagenetix > Incidental Mutations

Incidental Mutation 'R2310:Vmn2r112'

244758

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r112

Ensembl Gene

ENSMUSG00000094921

Gene Name

vomeronasal 2, receptor 112

Synonyms

EG628185

MMRRC Submission

040309-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R2310 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22601148-22619133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22603115 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 258 (V258E)

Ref Sequence

ENSEMBL: ENSMUSP00000094994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097381]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.8e-32	PFAM
Pfam:NCD3G	512	565	5.8e-21	PFAM
Pfam:7tm_3	598	833	6.5e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.2%
20x: 94.5%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef10l	A	C	4: 140,593,118	C136W	probably damaging	Het
Ascc3	T	A	10: 50,748,892	H1625Q	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cpa3	C	T	3: 20,227,223	C173Y	probably damaging	Het
Cyp2c65	A	G	19: 39,093,382	T451A	probably benign	Het
Ddx41	G	A	13: 55,534,480	R205W	possibly damaging	Het
Efhd1	T	C	1: 87,264,628	L60P	probably damaging	Het
Flrt2	A	G	12: 95,780,090	T401A	probably benign	Het
Frmd4a	GAA	G	2: 4,572,399		probably null	Het
Gas2l2	A	G	11: 83,427,439	V148A	possibly damaging	Het
Golga5	A	G	12: 102,492,161	E621G	probably damaging	Het
Gsap	A	T	5: 21,196,090	R74*	probably null	Het
Intu	C	T	3: 40,653,813	A85V	probably benign	Het
Kansl3	T	A	1: 36,343,364	I860F	probably damaging	Het
Kif23	A	G	9: 61,924,144	S715P	probably damaging	Het
Map3k8	A	T	18: 4,349,001	C106S	probably benign	Het
Mcc	T	C	18: 44,431,366	E934G	probably damaging	Het
Mrpl19	A	T	6: 81,964,073		probably null	Het
Msl3l2	C	A	10: 56,115,325	R49S	probably benign	Het
Muc6	T	A	7: 141,637,531	I2410F	possibly damaging	Het
Olfr1246	A	G	2: 89,590,450	S222P	probably damaging	Het
Olfr720	A	G	14: 14,175,836	V82A	probably benign	Het
Pip5k1c	T	G	10: 81,306,308	S117R	probably damaging	Het
Ppfia2	T	C	10: 106,854,980	S561P	probably damaging	Het
Pramef12	A	T	4: 144,392,905		probably null	Het
Rassf5	A	T	1: 131,244,740	W131R	probably damaging	Het
Shq1	C	T	6: 100,631,002	W316*	probably null	Het
Slc45a4	A	G	15: 73,589,560	Y87H	probably damaging	Het
Sptbn2	A	G	19: 4,718,935	D32G	probably benign	Het
Tjp1	C	T	7: 65,329,742	R345Q	possibly damaging	Het
Tnrc18	C	G	5: 142,788,553	V174L	probably damaging	Het
Trmt6	G	T	2: 132,808,912	P259T	probably damaging	Het
Ubap1	T	A	4: 41,379,341	V185E	possibly damaging	Het
Ulk1	C	T	5: 110,789,357	R691Q	probably benign	Het
Wnk2	T	C	13: 49,050,577	T1979A	probably damaging	Het
Xirp2	A	G	2: 67,526,247	D3784G	probably benign	Het
Zfp119a	A	T	17: 55,865,440	Y468N	probably benign	Het

Other mutations in Vmn2r112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Vmn2r112	APN	17	22618936	missense	probably benign	0.13
IGL01021:Vmn2r112	APN	17	22618904	missense	probably damaging	1.00
IGL01122:Vmn2r112	APN	17	22603007	missense	probably benign	0.00
IGL01360:Vmn2r112	APN	17	22618622	missense	probably benign	0.03
IGL01536:Vmn2r112	APN	17	22605155	missense	probably damaging	1.00
IGL02148:Vmn2r112	APN	17	22619032	missense	probably damaging	1.00
IGL02465:Vmn2r112	APN	17	22614994	missense	probably damaging	1.00
PIT4576001:Vmn2r112	UTSW	17	22614931	missense	probably benign	0.00
R0278:Vmn2r112	UTSW	17	22603006	missense	probably benign	0.44
R0328:Vmn2r112	UTSW	17	22605270	missense	probably benign	0.01
R0583:Vmn2r112	UTSW	17	22618949	missense	probably damaging	1.00
R0831:Vmn2r112	UTSW	17	22614999	missense	probably damaging	0.99
R1080:Vmn2r112	UTSW	17	22618999	missense	probably damaging	1.00
R1245:Vmn2r112	UTSW	17	22603247	missense	probably benign	0.03
R1321:Vmn2r112	UTSW	17	22618519	nonsense	probably null
R1381:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R1514:Vmn2r112	UTSW	17	22602844	missense	probably benign	0.40
R1519:Vmn2r112	UTSW	17	22618903	missense	possibly damaging	0.83
R1572:Vmn2r112	UTSW	17	22603144	missense	possibly damaging	0.61
R1590:Vmn2r112	UTSW	17	22615008	critical splice donor site	probably null
R1640:Vmn2r112	UTSW	17	22605116	missense	probably benign	0.01
R2221:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2223:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2312:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2337:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2339:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2340:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2341:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2342:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2401:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2860:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2861:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2926:Vmn2r112	UTSW	17	22615003	missense	possibly damaging	0.90
R3236:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3237:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3977:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3979:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R4168:Vmn2r112	UTSW	17	22603088	missense	probably benign	0.01
R4256:Vmn2r112	UTSW	17	22618412	missense	probably damaging	1.00
R4386:Vmn2r112	UTSW	17	22601322	missense	probably benign	0.36
R4912:Vmn2r112	UTSW	17	22603382	missense	probably damaging	0.99
R4947:Vmn2r112	UTSW	17	22602879	missense	probably benign	0.02
R5446:Vmn2r112	UTSW	17	22618250	missense	probably damaging	1.00
R5870:Vmn2r112	UTSW	17	22619023	missense	probably benign	0.00
R6351:Vmn2r112	UTSW	17	22601278	missense	probably benign
R6384:Vmn2r112	UTSW	17	22605155	missense	probably damaging	1.00
R6390:Vmn2r112	UTSW	17	22605249	missense	probably benign	0.01
R6401:Vmn2r112	UTSW	17	22603551	nonsense	probably null
R6405:Vmn2r112	UTSW	17	22618235	missense	probably damaging	1.00
R6620:Vmn2r112	UTSW	17	22603101	missense	probably benign	0.00
R6648:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R6649:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6653:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6654:Vmn2r112	UTSW	17	22603469	missense	possibly damaging	0.89
R6700:Vmn2r112	UTSW	17	22603481	missense	possibly damaging	0.53
R6993:Vmn2r112	UTSW	17	22603214	missense	probably benign	0.01
R7052:Vmn2r112	UTSW	17	22602526	missense	probably benign
R7454:Vmn2r112	UTSW	17	22603307	missense	probably benign	0.00
R7763:Vmn2r112	UTSW	17	22603118	missense	probably damaging	1.00
R8032:Vmn2r112	UTSW	17	22603394	missense	probably benign	0.21
Z1088:Vmn2r112	UTSW	17	22605078	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATGGCCTCTGATCATACATCTC -3'
(R):5'- TGACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GGCCTCTGATCATACATCTCTAGCC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'

Posted On

2014-10-30