Incidental Mutation 'R2310:Sptbn2'
ID244762
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Namespectrin beta, non-erythrocytic 2
SynonymsSpnb3
MMRRC Submission 040309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2310 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4711208-4752353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4718935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991]
Predicted Effect probably benign
Transcript: ENSMUST00000008991
AA Change: D32G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: D32G

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10l A C 4: 140,593,118 C136W probably damaging Het
Ascc3 T A 10: 50,748,892 H1625Q probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Cyp2c65 A G 19: 39,093,382 T451A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Efhd1 T C 1: 87,264,628 L60P probably damaging Het
Flrt2 A G 12: 95,780,090 T401A probably benign Het
Frmd4a GAA G 2: 4,572,399 probably null Het
Gas2l2 A G 11: 83,427,439 V148A possibly damaging Het
Golga5 A G 12: 102,492,161 E621G probably damaging Het
Gsap A T 5: 21,196,090 R74* probably null Het
Intu C T 3: 40,653,813 A85V probably benign Het
Kansl3 T A 1: 36,343,364 I860F probably damaging Het
Kif23 A G 9: 61,924,144 S715P probably damaging Het
Map3k8 A T 18: 4,349,001 C106S probably benign Het
Mcc T C 18: 44,431,366 E934G probably damaging Het
Mrpl19 A T 6: 81,964,073 probably null Het
Msl3l2 C A 10: 56,115,325 R49S probably benign Het
Muc6 T A 7: 141,637,531 I2410F possibly damaging Het
Olfr1246 A G 2: 89,590,450 S222P probably damaging Het
Olfr720 A G 14: 14,175,836 V82A probably benign Het
Pip5k1c T G 10: 81,306,308 S117R probably damaging Het
Ppfia2 T C 10: 106,854,980 S561P probably damaging Het
Pramef12 A T 4: 144,392,905 probably null Het
Rassf5 A T 1: 131,244,740 W131R probably damaging Het
Shq1 C T 6: 100,631,002 W316* probably null Het
Slc45a4 A G 15: 73,589,560 Y87H probably damaging Het
Tjp1 C T 7: 65,329,742 R345Q possibly damaging Het
Tnrc18 C G 5: 142,788,553 V174L probably damaging Het
Trmt6 G T 2: 132,808,912 P259T probably damaging Het
Ubap1 T A 4: 41,379,341 V185E possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnk2 T C 13: 49,050,577 T1979A probably damaging Het
Xirp2 A G 2: 67,526,247 D3784G probably benign Het
Zfp119a A T 17: 55,865,440 Y468N probably benign Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 intron probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTCTGGCTCCAGCAAAG -3'
(R):5'- TGTTTCTTCAGAGCAGCAGC -3'

Sequencing Primer
(F):5'- TGGTCTACAAGGCAAGTTCC -3'
(R):5'- CTTAGAGACCGAGGCAAGTCTTC -3'
Posted On2014-10-30