Incidental Mutation 'R2322:Tcim'
ID244778
Institutional Source Beutler Lab
Gene Symbol Tcim
Ensembl Gene ENSMUSG00000056313
Gene Nametranscriptional and immune response regulator
Synonyms1810011O10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R2322 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24437180-24438984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 24438710 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 63 (R63G)
Ref Sequence ENSEMBL: ENSMUSP00000058631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052622]
Predicted Effect probably damaging
Transcript: ENSMUST00000052622
AA Change: R63G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058631
Gene: ENSMUSG00000056313
AA Change: R63G

DomainStartEndE-ValueType
Pfam:TC1 10 85 5.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181338
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. This protein interacts with a repressor of beta-catenin mediated transcription at nuclear speckles. It is thought to competitively block interactions of the repressor with beta-catenin, resulting in up-regulation of beta-catenin target genes. The encoded protein may also play a role in the NF-kappaB and ERK1/2 signaling pathways. Expression of this gene may play a role in the proliferation of several types of cancer including thyroid cancer, breast cancer and hematological malignancies. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myeloid and lymphoid hyperplasia, an increased number of small-sized red blood cells, increased hematopoietic stem cell number, and enhanced hematopoietic activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
AY358078 A G 14: 51,804,690 Y174C unknown Het
Bod1l A T 5: 41,827,120 V529E probably benign Het
Brinp3 A G 1: 146,701,754 T176A probably benign Het
Cfap57 T A 4: 118,610,725 I272L probably benign Het
Cnr1 A G 4: 33,944,514 K301E probably damaging Het
Ctgf T C 10: 24,596,834 M214T probably damaging Het
Elavl1 A T 8: 4,289,802 L260H probably damaging Het
Ercc6 A G 14: 32,526,317 Y275C probably damaging Het
Fndc1 A G 17: 7,789,015 S96P probably damaging Het
Hykk G A 9: 54,946,134 G247S probably benign Het
Ky T C 9: 102,537,791 probably null Het
Mcu A C 10: 59,454,944 probably null Het
Olfr1131 T C 2: 87,628,774 C104R possibly damaging Het
Olfr1390 T G 11: 49,340,649 L39R probably damaging Het
Ppp4r3a C T 12: 101,042,619 R667Q probably damaging Het
Ptprj T C 2: 90,471,129 T220A probably benign Het
St18 T A 1: 6,844,124 C766* probably null Het
St8sia4 C T 1: 95,653,738 R93H probably damaging Het
Xylb T C 9: 119,388,747 S488P possibly damaging Het
Zhx3 T C 2: 160,782,028 D73G probably damaging Het
Other mutations in Tcim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Tcim APN 8 24438689 missense probably benign 0.04
IGL01937:Tcim APN 8 24438876 missense probably benign
IGL01945:Tcim APN 8 24438876 missense probably benign
R0464:Tcim UTSW 8 24438628 missense probably damaging 1.00
R0519:Tcim UTSW 8 24438635 missense possibly damaging 0.80
R3766:Tcim UTSW 8 24438749 missense probably damaging 0.98
R4623:Tcim UTSW 8 24438709 missense probably damaging 1.00
R6242:Tcim UTSW 8 24438895 start codon destroyed probably null 0.90
Predicted Primers PCR Primer
(F):5'- TCACTGGGTCTTTAAAGGTCC -3'
(R):5'- AACAGACTCCCCTGGAAGTG -3'

Sequencing Primer
(F):5'- CACTGGGTCTTTAAAGGTCCATTGG -3'
(R):5'- AAGTGCCCAAGCTGAGC -3'
Posted On2014-10-30