Incidental Mutation 'R2322:Hykk'
ID244779
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Namehydroxylysine kinase 1
SynonymsAgphd1, C630028N24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2322 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54917283-54949924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54946134 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 247 (G247S)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034848] [ENSMUST00000039742] [ENSMUST00000054018] [ENSMUST00000171900] [ENSMUST00000172407]
Predicted Effect probably benign
Transcript: ENSMUST00000034848
SMART Domains Protein: ENSMUSP00000034848
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 216 1.5e-57 PFAM
low complexity region 238 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039742
AA Change: G247S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: G247S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054018
SMART Domains Protein: ENSMUSP00000049861
Gene: ENSMUSG00000044820

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171578
Predicted Effect probably benign
Transcript: ENSMUST00000171900
SMART Domains Protein: ENSMUSP00000132368
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 139 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172407
SMART Domains Protein: ENSMUSP00000126844
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 210 3.2e-56 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
AY358078 A G 14: 51,804,690 Y174C unknown Het
Bod1l A T 5: 41,827,120 V529E probably benign Het
Brinp3 A G 1: 146,701,754 T176A probably benign Het
Cfap57 T A 4: 118,610,725 I272L probably benign Het
Cnr1 A G 4: 33,944,514 K301E probably damaging Het
Ctgf T C 10: 24,596,834 M214T probably damaging Het
Elavl1 A T 8: 4,289,802 L260H probably damaging Het
Ercc6 A G 14: 32,526,317 Y275C probably damaging Het
Fndc1 A G 17: 7,789,015 S96P probably damaging Het
Ky T C 9: 102,537,791 probably null Het
Mcu A C 10: 59,454,944 probably null Het
Olfr1131 T C 2: 87,628,774 C104R possibly damaging Het
Olfr1390 T G 11: 49,340,649 L39R probably damaging Het
Ppp4r3a C T 12: 101,042,619 R667Q probably damaging Het
Ptprj T C 2: 90,471,129 T220A probably benign Het
St18 T A 1: 6,844,124 C766* probably null Het
St8sia4 C T 1: 95,653,738 R93H probably damaging Het
Tcim G C 8: 24,438,710 R63G probably damaging Het
Xylb T C 9: 119,388,747 S488P possibly damaging Het
Zhx3 T C 2: 160,782,028 D73G probably damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54920558 missense possibly damaging 0.83
IGL02890:Hykk APN 9 54920711 missense probably benign 0.04
hike UTSW 9 54946479 missense probably benign 0.00
spatziergangen UTSW 9 54920726 missense possibly damaging 0.53
R0070:Hykk UTSW 9 54922348 splice site probably benign
R0734:Hykk UTSW 9 54946432 missense possibly damaging 0.93
R0830:Hykk UTSW 9 54937317 missense probably damaging 1.00
R1905:Hykk UTSW 9 54946383 missense probably benign
R4632:Hykk UTSW 9 54946516 missense probably benign 0.01
R4846:Hykk UTSW 9 54920606 missense probably damaging 1.00
R5088:Hykk UTSW 9 54946479 missense probably benign 0.00
R5410:Hykk UTSW 9 54946066 missense probably damaging 1.00
R6292:Hykk UTSW 9 54920826 critical splice donor site probably null
R6416:Hykk UTSW 9 54946359 missense probably benign 0.03
R6983:Hykk UTSW 9 54946509 missense probably benign 0.00
R7261:Hykk UTSW 9 54920726 missense possibly damaging 0.53
R7276:Hykk UTSW 9 54946218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCACATAAGACCCTGTGTC -3'
(R):5'- AAAGCCTGCCTCTCTACAGC -3'

Sequencing Primer
(F):5'- GACCCTGTGTCTCCCCC -3'
(R):5'- CCGTCAGGGGGATCACACTTTC -3'
Posted On2014-10-30