Incidental Mutation 'R2322:Ky'
ID244780
Institutional Source Beutler Lab
Gene Symbol Ky
Ensembl Gene ENSMUSG00000035606
Gene Namekyphoscoliosis peptidase
SynonymsD9Mgc44e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R2322 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102505750-102546239 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 102537791 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039390]
Predicted Effect probably null
Transcript: ENSMUST00000039390
SMART Domains Protein: ENSMUSP00000036032
Gene: ENSMUSG00000035606

DomainStartEndE-ValueType
TGc 217 285 1.9e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe degenerative myopathy involving postural muscles, resulting in thoraco-lumbar kyphoscoliosis with degenerative changes in intervertebral discs. Body weight is reduced and breathing is irregular. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
AY358078 A G 14: 51,804,690 Y174C unknown Het
Bod1l A T 5: 41,827,120 V529E probably benign Het
Brinp3 A G 1: 146,701,754 T176A probably benign Het
Cfap57 T A 4: 118,610,725 I272L probably benign Het
Cnr1 A G 4: 33,944,514 K301E probably damaging Het
Ctgf T C 10: 24,596,834 M214T probably damaging Het
Elavl1 A T 8: 4,289,802 L260H probably damaging Het
Ercc6 A G 14: 32,526,317 Y275C probably damaging Het
Fndc1 A G 17: 7,789,015 S96P probably damaging Het
Hykk G A 9: 54,946,134 G247S probably benign Het
Mcu A C 10: 59,454,944 probably null Het
Olfr1131 T C 2: 87,628,774 C104R possibly damaging Het
Olfr1390 T G 11: 49,340,649 L39R probably damaging Het
Ppp4r3a C T 12: 101,042,619 R667Q probably damaging Het
Ptprj T C 2: 90,471,129 T220A probably benign Het
St18 T A 1: 6,844,124 C766* probably null Het
St8sia4 C T 1: 95,653,738 R93H probably damaging Het
Tcim G C 8: 24,438,710 R63G probably damaging Het
Xylb T C 9: 119,388,747 S488P possibly damaging Het
Zhx3 T C 2: 160,782,028 D73G probably damaging Het
Other mutations in Ky
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ky APN 9 102542105 missense probably benign
IGL02197:Ky APN 9 102537786 missense possibly damaging 0.63
PIT4802001:Ky UTSW 9 102537773 missense probably benign 0.00
R0384:Ky UTSW 9 102542090 missense probably benign 0.05
R0620:Ky UTSW 9 102537621 missense probably benign 0.04
R1099:Ky UTSW 9 102537724 missense probably damaging 1.00
R1754:Ky UTSW 9 102541927 missense possibly damaging 0.54
R2075:Ky UTSW 9 102542746 missense probably damaging 0.98
R2415:Ky UTSW 9 102541891 missense probably damaging 1.00
R3950:Ky UTSW 9 102542428 nonsense probably null
R4419:Ky UTSW 9 102542710 missense probably damaging 1.00
R4786:Ky UTSW 9 102541987 missense probably benign 0.02
R5261:Ky UTSW 9 102537599 critical splice acceptor site probably null
R5529:Ky UTSW 9 102542075 missense probably benign 0.10
R6857:Ky UTSW 9 102542432 missense probably damaging 1.00
R6931:Ky UTSW 9 102537627 missense probably damaging 1.00
R7205:Ky UTSW 9 102542292 missense probably damaging 1.00
R7211:Ky UTSW 9 102509150 missense probably benign 0.08
R7570:Ky UTSW 9 102542329 missense probably benign 0.00
R7642:Ky UTSW 9 102542270 missense probably benign 0.32
R7644:Ky UTSW 9 102537773 missense probably benign 0.00
R7910:Ky UTSW 9 102541942 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TAGCACTCAAGCCCCTTCTCAG -3'
(R):5'- ATTCAGCTCCTTGCAAGCG -3'

Sequencing Primer
(F):5'- ATGTCCCATCCCCAGGGTTG -3'
(R):5'- CGACCTGGAACCAGCTTTTG -3'
Posted On2014-10-30