Incidental Mutation 'R2323:Catip'
ID244791
Institutional Source Beutler Lab
Gene Symbol Catip
Ensembl Gene ENSMUSG00000073650
Gene Nameciliogenesis associated TTC17 interacting protein
SynonymsGm216, LOC241112
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2323 (G1)
Quality Score171
Status Not validated
Chromosome1
Chromosomal Location74362108-74369321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74363278 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 103 (M103L)
Ref Sequence ENSEMBL: ENSMUSP00000141181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097697] [ENSMUST00000128445] [ENSMUST00000191010]
Predicted Effect probably benign
Transcript: ENSMUST00000097697
AA Change: M84L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095303
Gene: ENSMUSG00000073650
AA Change: M84L

DomainStartEndE-ValueType
low complexity region 67 83 N/A INTRINSIC
low complexity region 299 307 N/A INTRINSIC
coiled coil region 341 383 N/A INTRINSIC
low complexity region 473 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128445
AA Change: M128L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117442
Gene: ENSMUSG00000073650
AA Change: M128L

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 111 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186688
Predicted Effect probably benign
Transcript: ENSMUST00000191010
AA Change: M103L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141181
Gene: ENSMUSG00000073650
AA Change: M103L

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
coiled coil region 360 402 N/A INTRINSIC
low complexity region 492 518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Catip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Catip APN 1 74362795 missense probably damaging 1.00
IGL01774:Catip APN 1 74368483 missense probably damaging 1.00
IGL02532:Catip APN 1 74364616 missense probably damaging 0.97
IGL03117:Catip APN 1 74364585 missense probably null 0.02
R0165:Catip UTSW 1 74368469 missense possibly damaging 0.93
R0760:Catip UTSW 1 74362959 splice site probably benign
R1384:Catip UTSW 1 74364363 missense probably benign 0.04
R1538:Catip UTSW 1 74364652 nonsense probably null
R1710:Catip UTSW 1 74362770 missense possibly damaging 0.93
R2255:Catip UTSW 1 74369000 unclassified probably benign
R4429:Catip UTSW 1 74368732 unclassified probably benign
R4630:Catip UTSW 1 74368913 unclassified probably benign
R5249:Catip UTSW 1 74362795 missense probably damaging 1.00
R6057:Catip UTSW 1 74362918 missense probably damaging 1.00
R7176:Catip UTSW 1 74362782 missense probably damaging 1.00
R7495:Catip UTSW 1 74362692 missense probably benign 0.01
R7568:Catip UTSW 1 74368930 nonsense probably null
R7635:Catip UTSW 1 74368962 missense unknown
R8084:Catip UTSW 1 74364356 missense probably damaging 0.97
Z1176:Catip UTSW 1 74367789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTAATTGGGACCTGCC -3'
(R):5'- AAACCAACCGTGTGTGGTGC -3'

Sequencing Primer
(F):5'- CCCTTGACTTACCTGGGAGAG -3'
(R):5'- CCGTGTGTGGTGCAGGTTC -3'
Posted On2014-10-30