Incidental Mutation 'R2323:Myt1'
ID244795
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181806557 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 594 (A594S)
Ref Sequence ENSEMBL: ENSMUSP00000104388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757] [ENSMUST00000135744] [ENSMUST00000183403]
Predicted Effect probably damaging
Transcript: ENSMUST00000081125
AA Change: A674S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505
AA Change: A674S

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108756
AA Change: A632S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505
AA Change: A632S

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108757
AA Change: A594S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505
AA Change: A594S

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129843
AA Change: A335S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505
AA Change: A335S

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129856
AA Change: A365S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122011
Gene: ENSMUSG00000010505
AA Change: A365S

DomainStartEndE-ValueType
Pfam:zf-C2HC 63 91 1.4e-16 PFAM
low complexity region 147 152 N/A INTRINSIC
Pfam:zf-C2HC 177 204 4.6e-15 PFAM
Pfam:zf-C2HC 221 249 6.7e-17 PFAM
Pfam:MYT1 296 352 5.2e-29 PFAM
Pfam:MYT1 351 527 4.5e-57 PFAM
Pfam:zf-C2HC 535 556 1.4e-13 PFAM
Pfam:zf-C2HC 556 584 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130079
Predicted Effect probably benign
Transcript: ENSMUST00000135744
SMART Domains Protein: ENSMUSP00000121394
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 40 70 4.8e-21 PFAM
Pfam:zf-C2HC 89 119 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142245
Predicted Effect probably benign
Transcript: ENSMUST00000183403
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R0744:Myt1 UTSW 2 181797505 intron probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1471:Myt1 UTSW 2 181797111 missense probably benign
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2926:Myt1 UTSW 2 181826010 missense possibly damaging 0.93
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5111:Myt1 UTSW 2 181795885 missense probably benign 0.01
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
R7385:Myt1 UTSW 2 181767705 splice site probably null
R7411:Myt1 UTSW 2 181815106 missense probably damaging 1.00
R7593:Myt1 UTSW 2 181797739 missense possibly damaging 0.54
R7790:Myt1 UTSW 2 181797597 missense probably benign 0.00
R8035:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R8156:Myt1 UTSW 2 181822761 critical splice donor site probably null
R8338:Myt1 UTSW 2 181801862 missense possibly damaging 0.94
R8419:Myt1 UTSW 2 181782606 nonsense probably null
RF006:Myt1 UTSW 2 181797773 missense probably damaging 1.00
Z1177:Myt1 UTSW 2 181797162 missense probably damaging 0.97
Z1177:Myt1 UTSW 2 181807602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTATGCCTTGACCCCTAG -3'
(R):5'- AGCTTCCAGTTGCTCTTGGC -3'

Sequencing Primer
(F):5'- ATGCCTTGACCCCTAGCTCTC -3'
(R):5'- GCACCAGCCATAGCCTTACTG -3'
Posted On2014-10-30