Incidental Mutation 'R2323:Ints12'
ID244796
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Nameintegrator complex subunit 12
SynonymsPhf22, 2810027J24Rik, 1110020M19Rik, 4930529N21Rik, A230056J18Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133091840-133110988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133109365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 444 (M444I)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650] [ENSMUST00000147041]
PDB Structure
Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029650
AA Change: M444I

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: M444I

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147041
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Meta Mutation Damage Score 0.1323 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 133100809 critical splice donor site probably null
R0243:Ints12 UTSW 3 133109045 missense probably benign 0.37
R0847:Ints12 UTSW 3 133108842 missense possibly damaging 0.72
R2118:Ints12 UTSW 3 133109160 missense probably damaging 0.98
R2324:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2384:Ints12 UTSW 3 133109103 unclassified probably null
R3055:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3056:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3919:Ints12 UTSW 3 133100683 missense probably benign
R4431:Ints12 UTSW 3 133102481 missense probably damaging 1.00
R4594:Ints12 UTSW 3 133108868 missense probably benign 0.00
R4598:Ints12 UTSW 3 133098453 missense probably benign
R4599:Ints12 UTSW 3 133098453 missense probably benign
R4702:Ints12 UTSW 3 133096785 missense probably damaging 1.00
R5083:Ints12 UTSW 3 133100777 missense possibly damaging 0.54
R5507:Ints12 UTSW 3 133109160 missense probably damaging 1.00
R5894:Ints12 UTSW 3 133098558 missense probably damaging 1.00
R6647:Ints12 UTSW 3 133096878 missense possibly damaging 0.88
Z1176:Ints12 UTSW 3 133102464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTGGGTCTTCCTAGTCCTAG -3'
(R):5'- TGAAGCTCTTGTCATGCATCAG -3'

Sequencing Primer
(F):5'- CCTAGTCCTAGTAGTTTAGTTCCTGG -3'
(R):5'- TGTCATGCATCAGTCATTATAATCAC -3'
Posted On2014-10-30