Incidental Mutation 'R2323:5830473C10Rik'
ID244798
Institutional Source Beutler Lab
Gene Symbol 5830473C10Rik
Ensembl Gene ENSMUSG00000070690
Gene NameRIKEN cDNA 5830473C10 gene
SynonymsGm17754, ARG
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90561107-90597871 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 90584852 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 507 (Y507*)
Ref Sequence ENSEMBL: ENSMUSP00000092198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094615]
Predicted Effect probably null
Transcript: ENSMUST00000094615
AA Change: Y507*
SMART Domains Protein: ENSMUSP00000092198
Gene: ENSMUSG00000070690
AA Change: Y507*

DomainStartEndE-ValueType
ALBUMIN 17 207 8.87e-26 SMART
ALBUMIN 214 399 1.45e-53 SMART
ALBUMIN 406 598 7.07e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200893
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in 5830473C10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:5830473C10Rik APN 5 90579579 unclassified probably benign
IGL02343:5830473C10Rik APN 5 90579614 missense probably damaging 0.99
IGL02749:5830473C10Rik APN 5 90571765 missense possibly damaging 0.84
IGL02956:5830473C10Rik APN 5 90579638 missense possibly damaging 0.46
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0097:5830473C10Rik UTSW 5 90584936 missense probably benign 0.02
R0513:5830473C10Rik UTSW 5 90577927 missense probably benign 0.00
R0551:5830473C10Rik UTSW 5 90572719 missense probably damaging 1.00
R1508:5830473C10Rik UTSW 5 90581921 missense probably benign 0.00
R1797:5830473C10Rik UTSW 5 90579601 missense probably damaging 0.99
R2205:5830473C10Rik UTSW 5 90569562 missense possibly damaging 0.50
R2440:5830473C10Rik UTSW 5 90572689 critical splice acceptor site probably null
R4074:5830473C10Rik UTSW 5 90592868 splice site probably null
R4211:5830473C10Rik UTSW 5 90564237 missense probably damaging 1.00
R4426:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R4625:5830473C10Rik UTSW 5 90571752 missense probably damaging 0.99
R4823:5830473C10Rik UTSW 5 90566503 missense probably benign 0.01
R4922:5830473C10Rik UTSW 5 90579711 missense possibly damaging 0.84
R4923:5830473C10Rik UTSW 5 90561299 missense probably benign 0.07
R5218:5830473C10Rik UTSW 5 90581918 missense probably benign 0.34
R5267:5830473C10Rik UTSW 5 90584857 missense probably damaging 0.99
R5447:5830473C10Rik UTSW 5 90584310 missense probably damaging 1.00
R5737:5830473C10Rik UTSW 5 90572783 missense probably damaging 1.00
R5966:5830473C10Rik UTSW 5 90571687 missense probably damaging 1.00
R6045:5830473C10Rik UTSW 5 90584989 missense possibly damaging 0.86
R6290:5830473C10Rik UTSW 5 90593005 critical splice donor site probably null
R6799:5830473C10Rik UTSW 5 90579615 missense probably damaging 0.99
R6923:5830473C10Rik UTSW 5 90577793 missense probably benign 0.32
R7088:5830473C10Rik UTSW 5 90572750 nonsense probably null
R7238:5830473C10Rik UTSW 5 90579660 missense probably damaging 1.00
R7319:5830473C10Rik UTSW 5 90571766 critical splice donor site probably null
R7631:5830473C10Rik UTSW 5 90579672 missense probably damaging 1.00
R7798:5830473C10Rik UTSW 5 90597511 missense possibly damaging 0.72
R7821:5830473C10Rik UTSW 5 90592888 missense possibly damaging 0.95
R8041:5830473C10Rik UTSW 5 90593005 critical splice donor site probably null
R8353:5830473C10Rik UTSW 5 90566501 missense possibly damaging 0.67
R8453:5830473C10Rik UTSW 5 90566501 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGTGGATCGCACAAGTGATTG -3'
(R):5'- CTGGCTTAAAGTTCTCCACACAAG -3'

Sequencing Primer
(F):5'- CACAAGTGATTGTGTTAGTACCTG -3'
(R):5'- AGCCACCTTGTGCCTAAC -3'
Posted On2014-10-30