Incidental Mutation 'R2323:Vmn1r26'
ID244803
Institutional Source Beutler Lab
Gene Symbol Vmn1r26
Ensembl Gene ENSMUSG00000048697
Gene Namevomeronasal 1 receptor 26
SynonymsV1rc17
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location58004934-58015159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58008857 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 116 (K116E)
Ref Sequence ENSEMBL: ENSMUSP00000154463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049694] [ENSMUST00000228040] [ENSMUST00000228070] [ENSMUST00000228951]
Predicted Effect probably damaging
Transcript: ENSMUST00000049694
AA Change: K116E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052301
Gene: ENSMUSG00000048697
AA Change: K116E

DomainStartEndE-ValueType
Pfam:V1R 28 293 5.8e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228040
AA Change: K116E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228070
AA Change: K116E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228951
AA Change: K116E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Vmn1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Vmn1r26 APN 6 58009142 missense possibly damaging 0.81
IGL02609:Vmn1r26 APN 6 58008875 missense probably damaging 1.00
R1121:Vmn1r26 UTSW 6 58008662 missense probably benign 0.43
R1881:Vmn1r26 UTSW 6 58008665 missense probably benign 0.20
R1958:Vmn1r26 UTSW 6 58008301 missense probably benign 0.01
R1978:Vmn1r26 UTSW 6 58009126 missense possibly damaging 0.83
R2106:Vmn1r26 UTSW 6 58008725 missense possibly damaging 0.69
R2117:Vmn1r26 UTSW 6 58008350 missense possibly damaging 0.65
R4917:Vmn1r26 UTSW 6 58008823 missense probably damaging 0.99
R5695:Vmn1r26 UTSW 6 58008753 missense probably damaging 1.00
R6355:Vmn1r26 UTSW 6 58008551 missense probably benign 0.02
R6948:Vmn1r26 UTSW 6 58008733 missense probably damaging 0.98
R7114:Vmn1r26 UTSW 6 58008770 missense probably benign 0.02
RF020:Vmn1r26 UTSW 6 58008720 missense probably benign 0.35
Z1176:Vmn1r26 UTSW 6 58008597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATGCACTTGTTGTCACCATG -3'
(R):5'- TTGGCTTACAGACTTATTTGCG -3'

Sequencing Primer
(F):5'- GTCACTGTTAAAATCAATCCCCTG -3'
(R):5'- CAGACTTATTTGCGTCACTGAAC -3'
Posted On2014-10-30