Incidental Mutation 'R2323:Olfr652'
ID244806
Institutional Source Beutler Lab
Gene Symbol Olfr652
Ensembl Gene ENSMUSG00000073927
Gene Nameolfactory receptor 652
SynonymsMOR31-8, GA_x6K02T2PBJ9-7191524-7192471
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104560901-104568634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104564619 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 133 (F133L)
Ref Sequence ENSEMBL: ENSMUSP00000152027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098175] [ENSMUST00000215410] [ENSMUST00000216131] [ENSMUST00000219111]
Predicted Effect probably benign
Transcript: ENSMUST00000098175
AA Change: F133L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095777
Gene: ENSMUSG00000073927
AA Change: F133L

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:7tm_4 36 315 2.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 40 312 6.9e-9 PFAM
Pfam:7tm_1 46 297 4.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215410
AA Change: F133L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000216131
AA Change: F133L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000219111
AA Change: F133L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Olfr652
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr652 APN 7 104564829 missense probably damaging 1.00
IGL01620:Olfr652 APN 7 104565013 missense probably damaging 0.97
IGL01712:Olfr652 APN 7 104565019 missense probably benign
IGL02211:Olfr652 APN 7 104565126 nonsense probably null
IGL03328:Olfr652 APN 7 104564470 missense probably damaging 1.00
K7894:Olfr652 UTSW 7 104564532 missense probably benign 0.12
R0138:Olfr652 UTSW 7 104565003 missense probably benign
R0632:Olfr652 UTSW 7 104564337 missense probably benign 0.00
R1457:Olfr652 UTSW 7 104565071 missense probably damaging 1.00
R1494:Olfr652 UTSW 7 104564831 nonsense probably null
R1879:Olfr652 UTSW 7 104564911 missense possibly damaging 0.93
R2188:Olfr652 UTSW 7 104564676 missense probably benign 0.00
R3862:Olfr652 UTSW 7 104564938 missense probably benign 0.01
R3908:Olfr652 UTSW 7 104564641 missense probably benign 0.01
R4942:Olfr652 UTSW 7 104565005 missense probably benign 0.00
R5443:Olfr652 UTSW 7 104564376 missense probably benign 0.14
R5572:Olfr652 UTSW 7 104564994 missense probably benign 0.08
R6045:Olfr652 UTSW 7 104564767 missense probably benign 0.42
R6973:Olfr652 UTSW 7 104564976 missense probably benign 0.42
R7147:Olfr652 UTSW 7 104564066 start gained probably benign
R7349:Olfr652 UTSW 7 104564650 missense probably benign
R7968:Olfr652 UTSW 7 104564650 missense probably benign 0.01
R8031:Olfr652 UTSW 7 104565109 missense probably damaging 0.99
R8129:Olfr652 UTSW 7 104564377 missense probably benign 0.07
R8198:Olfr652 UTSW 7 104564933 missense probably benign 0.01
R8296:Olfr652 UTSW 7 104564386 missense probably benign
R8345:Olfr652 UTSW 7 104564224 start codon destroyed probably null 0.08
X0024:Olfr652 UTSW 7 104564250 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGTGGCATTTGCAGGCAAC -3'
(R):5'- TGCCTATGTGCTCACAGTATG -3'

Sequencing Primer
(F):5'- CTACCTCATTTTTATGGAGCGTAG -3'
(R):5'- ATGTGTGAGGAATGACGAGCTCTC -3'
Posted On2014-10-30