Incidental Mutation 'R2323:Ints10'
ID244807
Institutional Source Beutler Lab
Gene Symbol Ints10
Ensembl Gene ENSMUSG00000031864
Gene Nameintegrator complex subunit 10
Synonyms4921521J11Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location68793929-68831667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68819345 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 566 (H566R)
Ref Sequence ENSEMBL: ENSMUSP00000105871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]
Predicted Effect probably benign
Transcript: ENSMUST00000034328
AA Change: H566R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: H566R

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070713
AA Change: H566R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: H566R

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110241
AA Change: H566R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: H566R

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110242
AA Change: H566R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: H566R

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140309
Predicted Effect probably benign
Transcript: ENSMUST00000147072
SMART Domains Protein: ENSMUSP00000118390
Gene: ENSMUSG00000031864

DomainStartEndE-ValueType
low complexity region 92 111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Ints10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Ints10 APN 8 68819333 missense probably damaging 1.00
IGL00964:Ints10 APN 8 68811986 missense probably damaging 1.00
IGL02326:Ints10 APN 8 68804833 missense probably damaging 0.99
R0012:Ints10 UTSW 8 68807475 missense probably benign 0.01
R0112:Ints10 UTSW 8 68827302 missense probably damaging 0.99
R1302:Ints10 UTSW 8 68827312 missense probably damaging 1.00
R1462:Ints10 UTSW 8 68807644 splice site probably benign
R1540:Ints10 UTSW 8 68796713 splice site probably benign
R1592:Ints10 UTSW 8 68802903 missense possibly damaging 0.69
R1845:Ints10 UTSW 8 68794671 missense probably damaging 1.00
R2144:Ints10 UTSW 8 68796805 missense probably damaging 1.00
R3765:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R3910:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3912:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3913:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R4050:Ints10 UTSW 8 68827351 missense probably damaging 1.00
R4151:Ints10 UTSW 8 68794598 splice site probably null
R4607:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4608:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4881:Ints10 UTSW 8 68810604 missense probably benign 0.08
R4911:Ints10 UTSW 8 68827312 missense probably damaging 0.98
R5255:Ints10 UTSW 8 68793972 start gained probably benign
R5331:Ints10 UTSW 8 68820820 splice site probably null
R5461:Ints10 UTSW 8 68794041 missense possibly damaging 0.59
R5740:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R5741:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R6128:Ints10 UTSW 8 68822252 critical splice donor site probably null
R6465:Ints10 UTSW 8 68807536 missense probably benign
R6868:Ints10 UTSW 8 68797798 missense probably damaging 1.00
R6983:Ints10 UTSW 8 68794051 missense probably damaging 1.00
R7076:Ints10 UTSW 8 68796751 nonsense probably null
R7216:Ints10 UTSW 8 68822157 missense probably damaging 0.96
R7652:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R8134:Ints10 UTSW 8 68802986 nonsense probably null
R8176:Ints10 UTSW 8 68802951 missense probably damaging 1.00
R8185:Ints10 UTSW 8 68796718 missense possibly damaging 0.51
X0027:Ints10 UTSW 8 68808474 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAAACCATTGTCATCGTTACAC -3'
(R):5'- TATTCCTCAAGCACAGGGC -3'

Sequencing Primer
(F):5'- CAATTAATTGTTGTCTGCTGTGTCTC -3'
(R):5'- GCACAGGGCTTATTTTCTACTTC -3'
Posted On2014-10-30