Incidental Mutation 'R2323:Esrp2'
ID244808
Institutional Source Beutler Lab
Gene Symbol Esrp2
Ensembl Gene ENSMUSG00000084128
Gene Nameepithelial splicing regulatory protein 2
Synonyms9530027K23Rik, Rbm35b
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106130319-106136974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106134302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000123114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000115979] [ENSMUST00000146940]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115979
AA Change: D196V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111639
Gene: ENSMUSG00000084128
AA Change: D196V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 248 320 2.58e-1 SMART
RRM 349 424 2.67e-2 SMART
low complexity region 439 459 N/A INTRINSIC
RRM 466 541 4.17e-3 SMART
low complexity region 549 575 N/A INTRINSIC
low complexity region 593 614 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145343
Predicted Effect probably benign
Transcript: ENSMUST00000146940
AA Change: D196V

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123114
Gene: ENSMUSG00000084128
AA Change: D196V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 247 319 2.58e-1 SMART
RRM 348 423 2.67e-2 SMART
low complexity region 438 458 N/A INTRINSIC
RRM 465 540 4.17e-3 SMART
low complexity region 548 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR2 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Homozygous null mice exhibit defects in hepatic maturation, and decreased serum albumin levels and total serum protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Esrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Esrp2 APN 8 106132233 missense probably benign 0.00
R0419:Esrp2 UTSW 8 106134675 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1528:Esrp2 UTSW 8 106136752 missense unknown
R1598:Esrp2 UTSW 8 106133273 missense probably damaging 0.97
R1817:Esrp2 UTSW 8 106134618 missense probably damaging 1.00
R1885:Esrp2 UTSW 8 106131821 missense possibly damaging 0.80
R1886:Esrp2 UTSW 8 106133857 missense probably damaging 1.00
R3761:Esrp2 UTSW 8 106133622 missense probably damaging 1.00
R4598:Esrp2 UTSW 8 106132711 missense probably damaging 1.00
R4792:Esrp2 UTSW 8 106132509 missense probably damaging 1.00
R5091:Esrp2 UTSW 8 106132429 missense probably damaging 1.00
R5114:Esrp2 UTSW 8 106132188 missense probably benign 0.42
R5162:Esrp2 UTSW 8 106133298 missense probably damaging 1.00
R5678:Esrp2 UTSW 8 106132118 missense probably damaging 0.97
R5947:Esrp2 UTSW 8 106132933 unclassified probably benign
R7713:Esrp2 UTSW 8 106134276 missense probably benign 0.01
R7760:Esrp2 UTSW 8 106133470 missense probably benign 0.03
R8348:Esrp2 UTSW 8 106132221 missense probably damaging 1.00
R8448:Esrp2 UTSW 8 106132221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGGGGTTTCTACCTTG -3'
(R):5'- CATGTGCATGATGCCGTATGG -3'

Sequencing Primer
(F):5'- CAGAGGGGTTTCTACCTTGTGTTCTC -3'
(R):5'- AGACAGGTCTATGTTTTTAGCCTC -3'
Posted On2014-10-30