Incidental Mutation 'R2323:Zfp558'
ID244809
Institutional Source Beutler Lab
Gene Symbol Zfp558
Ensembl Gene ENSMUSG00000074500
Gene Namezinc finger protein 558
SynonymsZfp558-ps, 1700007A21Rik, 4932704I17Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18455575-18478268 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 18469277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034647] [ENSMUST00000034647] [ENSMUST00000159596]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034646
Predicted Effect probably null
Transcript: ENSMUST00000034647
SMART Domains Protein: ENSMUSP00000132305
Gene: ENSMUSG00000074500

DomainStartEndE-ValueType
KRAB 43 103 2.52e-29 SMART
ZnF_C2H2 156 178 1.45e-2 SMART
ZnF_C2H2 184 206 2.79e-4 SMART
ZnF_C2H2 212 234 6.52e-5 SMART
ZnF_C2H2 240 262 2.02e-1 SMART
ZnF_C2H2 269 291 5.14e-3 SMART
ZnF_C2H2 297 319 5.21e-4 SMART
ZnF_C2H2 325 347 1.3e-4 SMART
ZnF_C2H2 353 375 2.99e-4 SMART
ZnF_C2H2 381 403 3.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034647
SMART Domains Protein: ENSMUSP00000132305
Gene: ENSMUSG00000074500

DomainStartEndE-ValueType
KRAB 43 103 2.52e-29 SMART
ZnF_C2H2 156 178 1.45e-2 SMART
ZnF_C2H2 184 206 2.79e-4 SMART
ZnF_C2H2 212 234 6.52e-5 SMART
ZnF_C2H2 240 262 2.02e-1 SMART
ZnF_C2H2 269 291 5.14e-3 SMART
ZnF_C2H2 297 319 5.21e-4 SMART
ZnF_C2H2 325 347 1.3e-4 SMART
ZnF_C2H2 353 375 2.99e-4 SMART
ZnF_C2H2 381 403 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159596
SMART Domains Protein: ENSMUSP00000126946
Gene: ENSMUSG00000074500

DomainStartEndE-ValueType
KRAB 43 100 1.24e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Zfp558
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Zfp558 APN 9 18456587 missense possibly damaging 0.72
IGL00722:Zfp558 APN 9 18456521 missense probably damaging 0.97
R0270:Zfp558 UTSW 9 18467956 missense probably damaging 1.00
R0708:Zfp558 UTSW 9 18456827 missense possibly damaging 0.75
R1521:Zfp558 UTSW 9 18456563 missense possibly damaging 0.86
R1618:Zfp558 UTSW 9 18469283 missense possibly damaging 0.73
R2939:Zfp558 UTSW 9 18456628 missense possibly damaging 0.71
R4537:Zfp558 UTSW 9 18457502 missense probably null 0.72
R4569:Zfp558 UTSW 9 18456503 missense possibly damaging 0.72
R4570:Zfp558 UTSW 9 18456503 missense possibly damaging 0.72
R4571:Zfp558 UTSW 9 18456503 missense possibly damaging 0.72
R4619:Zfp558 UTSW 9 18456281 missense possibly damaging 0.96
R5207:Zfp558 UTSW 9 18457000 missense possibly damaging 0.93
R5530:Zfp558 UTSW 9 18456373 missense probably benign 0.05
R6631:Zfp558 UTSW 9 18456923 nonsense probably null
R7892:Zfp558 UTSW 9 18468697 missense possibly damaging 0.73
R8309:Zfp558 UTSW 9 18456917 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTGTCTCTCATATCCAAGG -3'
(R):5'- CAGTGTGCATCTTGAAGAAGGC -3'

Sequencing Primer
(F):5'- GTCTCTCATATCCAAGGACCACTGG -3'
(R):5'- GCTGAAAAGGGCTCATCCTC -3'
Posted On2014-10-30