Incidental Mutation 'R2323:Npsr1'
ID244810
Institutional Source Beutler Lab
Gene Symbol Npsr1
Ensembl Gene ENSMUSG00000043659
Gene Nameneuropeptide S receptor 1
SynonymsVRR1, PGR14, 9330128H10Rik, Gpr154
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location24097996-24316398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24300436 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 240 (K240E)
Ref Sequence ENSEMBL: ENSMUSP00000056432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059650] [ENSMUST00000154644]
Predicted Effect probably damaging
Transcript: ENSMUST00000059650
AA Change: K240E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056432
Gene: ENSMUSG00000043659
AA Change: K240E

DomainStartEndE-ValueType
Pfam:7tm_1 66 330 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154337
Predicted Effect probably damaging
Transcript: ENSMUST00000154644
AA Change: K87E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115126
Gene: ENSMUSG00000043659
AA Change: K87E

DomainStartEndE-ValueType
Pfam:7tm_1 2 177 2.7e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased airway resistance when treated with high concentrations of U-46619. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Npsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Npsr1 APN 9 24254693 missense probably damaging 1.00
IGL02505:Npsr1 APN 9 24098282 missense probably benign
IGL03306:Npsr1 APN 9 24313239 missense probably benign 0.41
IGL03350:Npsr1 APN 9 24098309 missense probably benign
R0057:Npsr1 UTSW 9 24300427 missense probably damaging 1.00
R0385:Npsr1 UTSW 9 24313277 missense probably damaging 0.99
R1432:Npsr1 UTSW 9 24310075 missense probably damaging 1.00
R2033:Npsr1 UTSW 9 24313352 missense probably benign
R2851:Npsr1 UTSW 9 24310005 splice site probably benign
R2852:Npsr1 UTSW 9 24310005 splice site probably benign
R4088:Npsr1 UTSW 9 24313769 missense possibly damaging 0.56
R4757:Npsr1 UTSW 9 24134768 missense probably benign 0.00
R4812:Npsr1 UTSW 9 24289956 missense probably damaging 0.98
R5175:Npsr1 UTSW 9 24134815 missense probably benign 0.11
R5475:Npsr1 UTSW 9 24300419 missense probably damaging 1.00
R5568:Npsr1 UTSW 9 24313214 missense probably damaging 1.00
R5722:Npsr1 UTSW 9 24313800 missense probably damaging 1.00
R6778:Npsr1 UTSW 9 24254618 missense possibly damaging 0.96
R6811:Npsr1 UTSW 9 24134809 missense probably benign 0.03
R6931:Npsr1 UTSW 9 24289997 missense probably benign 0.27
R7356:Npsr1 UTSW 9 24098261 missense probably benign 0.29
R7569:Npsr1 UTSW 9 24313730 missense probably benign 0.00
R7908:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
R8287:Npsr1 UTSW 9 24289962 missense probably damaging 1.00
R8325:Npsr1 UTSW 9 24286822 start gained probably benign
R8392:Npsr1 UTSW 9 24310081 missense possibly damaging 0.91
R8396:Npsr1 UTSW 9 24310081 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCTGTCAAGGATGGTTGAG -3'
(R):5'- CTCTCTCAGCTTTCAGGGAG -3'

Sequencing Primer
(F):5'- CAAGGATGGTTGAGATCCCTCTC -3'
(R):5'- TTGCAGGAGATAGGTTAGG -3'
Posted On2014-10-30