Mutagenetix > Incidental Mutations

Incidental Mutation 'R2323:Myo1e'

244811

Institutional Source

Beutler Lab

Gene Symbol

Myo1e

Ensembl Gene

ENSMUSG00000032220

Gene Name

myosin IE

Synonyms

2310020N23Rik, 9130023P14Rik

MMRRC Submission

040314-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2323 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70207350-70399766 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 70378758 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 941 (Y941*)

Ref Sequence

ENSEMBL: ENSMUSP00000034745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]

PDB Structure

MYOSIN 1E SH3 [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000034745
AA Change: Y941*

SMART Domains

Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: Y941*

Domain	Start	End	E-Value	Type
MYSc	13	693	N/A	SMART
Pfam:Myosin_TH1	719	917	1e-55	PFAM
SH3	1053	1107	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214042

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	T	A	5: 90,584,852	Y507*	probably null	Het
Abca2	G	T	2: 25,445,175	M2008I	probably benign	Het
Adgrv1	A	G	13: 81,595,179	S68P	probably damaging	Het
Anks3	T	C	16: 4,950,770		probably null	Het
Asap2	T	C	12: 21,203,968	I160T	probably damaging	Het
Asb15	T	A	6: 24,556,601	F32I	probably benign	Het
Catip	A	T	1: 74,363,278	M103L	probably benign	Het
Cela2a	G	C	4: 141,826,079		probably benign	Het
Crebrf	T	C	17: 26,763,607		probably benign	Het
Dnah10	T	C	5: 124,742,000	M450T	probably damaging	Het
Dst	T	C	1: 34,228,437	S5165P	possibly damaging	Het
Esrp2	T	A	8: 106,134,302	D196V	probably benign	Het
Hmox2	A	T	16: 4,765,856	K263*	probably null	Het
Ints10	A	G	8: 68,819,345	H566R	probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Liph	A	G	16: 21,984,004	V105A	probably damaging	Het
Myo7b	T	C	18: 31,971,345	E1450G	probably damaging	Het
Myt1	G	T	2: 181,806,557	A594S	probably damaging	Het
Npas3	T	A	12: 54,068,346	Y666N	probably damaging	Het
Npsr1	A	G	9: 24,300,436	K240E	probably damaging	Het
Olfr652	T	C	7: 104,564,619	F133L	probably benign	Het
Rtkn2	A	G	10: 68,001,934	I102M	probably damaging	Het
Rundc1	T	C	11: 101,425,275	F58L	probably damaging	Het
Snrpc	T	G	17: 27,847,974	M91R	unknown	Het
Tgfbr2	T	C	9: 116,110,144	K205R	possibly damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tnfrsf21	C	A	17: 43,085,529	S568*	probably null	Het
Tulp1	C	T	17: 28,362,482	G239D	probably damaging	Het
Vmn1r234	T	C	17: 21,229,703	I293T	probably benign	Het
Vmn1r26	T	C	6: 58,008,857	K116E	probably damaging	Het
Vmn2r98	T	A	17: 19,065,819	I193K	probably benign	Het
Wnk4	T	A	11: 101,268,481	S575T	probably damaging	Het
Zfp558	A	T	9: 18,469,277		probably null	Het
Zscan18	T	C	7: 12,775,459		probably benign	Het

Other mutations in Myo1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Myo1e	APN	9	70342148	missense	probably benign	0.01
IGL00833:Myo1e	APN	9	70338778	missense	probably damaging	0.99
IGL00973:Myo1e	APN	9	70338787	missense	probably damaging	1.00
IGL01011:Myo1e	APN	9	70316589	splice site	probably benign
IGL01401:Myo1e	APN	9	70327166	missense	probably damaging	0.97
IGL01402:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01404:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01613:Myo1e	APN	9	70341273	splice site	probably benign
IGL01738:Myo1e	APN	9	70359370	missense	probably damaging	1.00
IGL01819:Myo1e	APN	9	70343040	splice site	probably benign
IGL02233:Myo1e	APN	9	70383799	splice site	probably benign
IGL02244:Myo1e	APN	9	70367689	missense	probably benign	0.00
IGL02440:Myo1e	APN	9	70346740	missense	probably damaging	1.00
IGL02806:Myo1e	APN	9	70362270	missense	probably benign	0.01
IGL02886:Myo1e	APN	9	70368773	missense	probably benign	0.00
IGL03178:Myo1e	APN	9	70286949	missense	possibly damaging	0.47
I2288:Myo1e	UTSW	9	70342097	missense	possibly damaging	0.80
R0036:Myo1e	UTSW	9	70341308	missense	probably damaging	1.00
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0399:Myo1e	UTSW	9	70301793	splice site	probably benign
R0526:Myo1e	UTSW	9	70322398	missense	probably damaging	1.00
R0599:Myo1e	UTSW	9	70376660	splice site	probably benign
R0656:Myo1e	UTSW	9	70367674	missense	probably damaging	1.00
R1078:Myo1e	UTSW	9	70383999	missense	probably benign
R1278:Myo1e	UTSW	9	70398785	missense	probably damaging	1.00
R1300:Myo1e	UTSW	9	70301783	missense	probably damaging	1.00
R1329:Myo1e	UTSW	9	70338738	missense	possibly damaging	0.96
R1349:Myo1e	UTSW	9	70287069	splice site	probably benign
R1463:Myo1e	UTSW	9	70338756	missense	possibly damaging	0.88
R1656:Myo1e	UTSW	9	70395934	missense	probably damaging	1.00
R1727:Myo1e	UTSW	9	70376524	missense	possibly damaging	0.88
R1789:Myo1e	UTSW	9	70338784	missense	probably damaging	1.00
R1970:Myo1e	UTSW	9	70368773	missense	probably benign	0.00
R2029:Myo1e	UTSW	9	70368687	missense	possibly damaging	0.78
R2029:Myo1e	UTSW	9	70378715	splice site	probably benign
R2039:Myo1e	UTSW	9	70320133	missense	possibly damaging	0.89
R2076:Myo1e	UTSW	9	70383877	missense	probably benign
R2256:Myo1e	UTSW	9	70378373	splice site	probably null
R2257:Myo1e	UTSW	9	70378373	splice site	probably null
R2443:Myo1e	UTSW	9	70327172	missense	probably benign
R4023:Myo1e	UTSW	9	70324875	missense	probably benign
R4024:Myo1e	UTSW	9	70324875	missense	probably benign
R4025:Myo1e	UTSW	9	70324875	missense	probably benign
R4026:Myo1e	UTSW	9	70324875	missense	probably benign
R4151:Myo1e	UTSW	9	70297351	nonsense	probably null
R4764:Myo1e	UTSW	9	70343135	splice site	probably null
R4768:Myo1e	UTSW	9	70370469	missense	possibly damaging	0.63
R4911:Myo1e	UTSW	9	70343096	missense	probably benign
R4995:Myo1e	UTSW	9	70353272	missense	probably benign	0.01
R4999:Myo1e	UTSW	9	70353312	missense	probably damaging	1.00
R5228:Myo1e	UTSW	9	70322358	intron	probably null
R5414:Myo1e	UTSW	9	70322358	intron	probably null
R5577:Myo1e	UTSW	9	70370471	missense	probably benign	0.31
R5851:Myo1e	UTSW	9	70383804	missense	probably benign	0.17
R6208:Myo1e	UTSW	9	70376605	missense	probably damaging	0.99
R6907:Myo1e	UTSW	9	70327155	missense	probably benign
R7084:Myo1e	UTSW	9	70337801	missense	probably damaging	0.96
R7313:Myo1e	UTSW	9	70359385	critical splice donor site	probably null
R7383:Myo1e	UTSW	9	70297295	missense	probably damaging	1.00
R7811:Myo1e	UTSW	9	70327262	missense	probably damaging	0.96
X0021:Myo1e	UTSW	9	70378273	missense	probably damaging	0.99
X0065:Myo1e	UTSW	9	70378294	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CATTCATGTCTGAGCTGTGTTC -3'
(R):5'- GGGTTTCCTTCCCAAACACTG -3'

Sequencing Primer
(F):5'- CATGTCTGAGCTGTGTTCAAAGTC -3'
(R):5'- ATTGTACCTCAGGAGTGATGCACC -3'

Posted On

2014-10-30