Incidental Mutation 'R2323:Tgfbr2'
ID244812
Institutional Source Beutler Lab
Gene Symbol Tgfbr2
Ensembl Gene ENSMUSG00000032440
Gene Nametransforming growth factor, beta receptor II
SynonymsTbetaR-II, TBR-II, TbetaRII, 1110020H15Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location116084293-116175360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116110144 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 205 (K205R)
Ref Sequence ENSEMBL: ENSMUSP00000035014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035014
AA Change: K205R

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: K205R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 47 165 1.8e-55 PFAM
Pfam:Pkinase 244 538 9.9e-52 PFAM
Pfam:Pkinase_Tyr 244 538 2.9e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061101
AA Change: K230R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: K230R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 74 184 4.6e-45 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Pfam:Pkinase 269 563 2.7e-36 PFAM
Pfam:Pkinase_Tyr 269 563 5e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Tgfbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tgfbr2 APN 9 116110189 missense probably damaging 0.99
IGL00484:Tgfbr2 APN 9 116158289 missense probably benign 0.00
IGL01010:Tgfbr2 APN 9 116129980 missense possibly damaging 0.80
IGL01656:Tgfbr2 APN 9 116109669 missense probably damaging 1.00
IGL02496:Tgfbr2 APN 9 116090418 missense probably benign 0.13
IGL02550:Tgfbr2 APN 9 116110129 missense probably benign
IGL02563:Tgfbr2 APN 9 116129998 missense probably benign 0.10
IGL03403:Tgfbr2 APN 9 116110302 missense probably benign
IGL02799:Tgfbr2 UTSW 9 116110136 missense possibly damaging 0.50
R0617:Tgfbr2 UTSW 9 116158320 missense probably benign 0.00
R1483:Tgfbr2 UTSW 9 116109557 missense probably benign 0.04
R1776:Tgfbr2 UTSW 9 116174967 missense possibly damaging 0.94
R1777:Tgfbr2 UTSW 9 116109880 missense probably damaging 0.99
R1831:Tgfbr2 UTSW 9 116090536 missense possibly damaging 0.74
R2378:Tgfbr2 UTSW 9 116129950 missense probably benign 0.02
R3123:Tgfbr2 UTSW 9 116110069 missense possibly damaging 0.95
R3418:Tgfbr2 UTSW 9 116129833 missense probably damaging 1.00
R3605:Tgfbr2 UTSW 9 116109892 missense probably benign 0.03
R4039:Tgfbr2 UTSW 9 116175037 start codon destroyed probably null 0.62
R4191:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4193:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4945:Tgfbr2 UTSW 9 116131565 missense probably benign
R5431:Tgfbr2 UTSW 9 116131601 missense probably damaging 0.99
R5714:Tgfbr2 UTSW 9 116175024 missense probably damaging 0.98
R5964:Tgfbr2 UTSW 9 116110255 missense possibly damaging 0.64
R6180:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R6970:Tgfbr2 UTSW 9 116110051 missense probably damaging 0.97
R7228:Tgfbr2 UTSW 9 116109943 missense probably damaging 1.00
R7258:Tgfbr2 UTSW 9 116129830 missense probably damaging 0.98
R7315:Tgfbr2 UTSW 9 116109738 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACTGCTCTGAGGTGTTCTGC -3'
(R):5'- CCAGAGCCTAATGCCTTCTC -3'

Sequencing Primer
(F):5'- GCTTCAGCTTGGCCTTGTAGAC -3'
(R):5'- AGAGCCTAATGCCTTCTCTCCTTTG -3'
Posted On2014-10-30