Incidental Mutation 'R2323:Rtkn2'
ID244813
Institutional Source Beutler Lab
Gene Symbol Rtkn2
Ensembl Gene ENSMUSG00000037846
Gene Namerhotekin 2
SynonymsPlekhk1, B130039D23Rik, RTKN2, Mbf
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location67979570-68059740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68001934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 102 (I102M)
Ref Sequence ENSEMBL: ENSMUSP00000116166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068994] [ENSMUST00000105437] [ENSMUST00000117086] [ENSMUST00000118160] [ENSMUST00000147556]
Predicted Effect probably damaging
Transcript: ENSMUST00000068994
AA Change: I105M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070717
Gene: ENSMUSG00000037846
AA Change: I105M

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 93 243 4.9e-37 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105437
AA Change: I102M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846
AA Change: I102M

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117086
AA Change: I102M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846
AA Change: I102M

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118160
AA Change: I105M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846
AA Change: I105M

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147556
AA Change: I102M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116166
Gene: ENSMUSG00000037846
AA Change: I102M

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Rtkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rtkn2 APN 10 68041664 missense probably benign 0.00
IGL01338:Rtkn2 APN 10 68025519 missense possibly damaging 0.83
IGL01865:Rtkn2 APN 10 68035875 missense probably benign 0.44
IGL03074:Rtkn2 APN 10 68041721 missense probably damaging 0.99
IGL03383:Rtkn2 APN 10 68017837 missense probably damaging 1.00
PIT4520001:Rtkn2 UTSW 10 67987461 missense probably damaging 1.00
R1167:Rtkn2 UTSW 10 67997620 missense probably damaging 1.00
R2166:Rtkn2 UTSW 10 68041696 missense possibly damaging 0.55
R3826:Rtkn2 UTSW 10 67997626 splice site probably null
R3827:Rtkn2 UTSW 10 67997626 splice site probably null
R3828:Rtkn2 UTSW 10 67997626 splice site probably null
R3829:Rtkn2 UTSW 10 67997626 splice site probably null
R4742:Rtkn2 UTSW 10 68003314 missense possibly damaging 0.72
R4867:Rtkn2 UTSW 10 68001927 missense probably damaging 0.99
R4871:Rtkn2 UTSW 10 68005633 missense probably damaging 1.00
R4936:Rtkn2 UTSW 10 68041915 makesense probably null
R5009:Rtkn2 UTSW 10 68041409 missense probably benign 0.14
R5709:Rtkn2 UTSW 10 68001970 missense probably benign 0.31
R6295:Rtkn2 UTSW 10 67979699 start gained probably benign
R6307:Rtkn2 UTSW 10 68035832 missense possibly damaging 0.60
R6751:Rtkn2 UTSW 10 68041453 missense probably benign 0.43
R6823:Rtkn2 UTSW 10 68026632 missense probably damaging 0.96
R7011:Rtkn2 UTSW 10 67979665 unclassified probably benign
R7369:Rtkn2 UTSW 10 68041429 missense probably damaging 0.96
R7403:Rtkn2 UTSW 10 68005636 missense probably benign 0.18
R7760:Rtkn2 UTSW 10 68005609 missense probably damaging 1.00
R7803:Rtkn2 UTSW 10 67979813 critical splice donor site probably null
R7992:Rtkn2 UTSW 10 68040093 missense probably damaging 1.00
Z1177:Rtkn2 UTSW 10 68025603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGGATGGCCTCAGAAG -3'
(R):5'- ACAGTTTGCTGACAGGATGC -3'

Sequencing Primer
(F):5'- CAATTTCCACAGGACCTGAGTTGG -3'
(R):5'- GCTGACAGGATGCTTATAGCC -3'
Posted On2014-10-30