Incidental Mutation 'R2323:Rundc1'
ID244815
Institutional Source Beutler Lab
Gene Symbol Rundc1
Ensembl Gene ENSMUSG00000035007
Gene NameRUN domain containing 1
Synonyms
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101425085-101435673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101425275 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 58 (F58L)
Ref Sequence ENSEMBL: ENSMUSP00000042151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040561] [ENSMUST00000093933] [ENSMUST00000103102] [ENSMUST00000107252] [ENSMUST00000107257] [ENSMUST00000107259]
Predicted Effect probably damaging
Transcript: ENSMUST00000040561
AA Change: F58L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042151
Gene: ENSMUSG00000035007
AA Change: F58L

DomainStartEndE-ValueType
low complexity region 43 75 N/A INTRINSIC
coiled coil region 80 102 N/A INTRINSIC
coiled coil region 165 201 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
RUN 540 602 2.77e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093933
SMART Domains Protein: ENSMUSP00000091465
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103102
SMART Domains Protein: ENSMUSP00000099391
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107252
SMART Domains Protein: ENSMUSP00000102873
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 9.6e-9 PFAM
low complexity region 141 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107257
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107259
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149706
SMART Domains Protein: ENSMUSP00000116399
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
SCOP:d1ejfa_ 2 41 6e-11 SMART
PDB:1EJF|B 2 56 2e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Rundc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Rundc1 APN 11 101434274 missense probably damaging 1.00
IGL01068:Rundc1 APN 11 101434142 missense probably damaging 0.96
IGL02112:Rundc1 APN 11 101433599 missense probably benign 0.01
R0379:Rundc1 UTSW 11 101425147 missense probably benign 0.01
R1847:Rundc1 UTSW 11 101433681 missense probably benign
R1959:Rundc1 UTSW 11 101431496 missense probably damaging 1.00
R2185:Rundc1 UTSW 11 101425331 missense probably benign 0.34
R2225:Rundc1 UTSW 11 101431344 splice site probably benign
R3791:Rundc1 UTSW 11 101434201 missense probably damaging 0.96
R4599:Rundc1 UTSW 11 101433926 missense probably damaging 1.00
R4660:Rundc1 UTSW 11 101434004 missense possibly damaging 0.89
R4871:Rundc1 UTSW 11 101434048 missense probably benign 0.18
R5054:Rundc1 UTSW 11 101425141 missense probably benign 0.00
R5058:Rundc1 UTSW 11 101425537 missense probably benign
R6349:Rundc1 UTSW 11 101434162 missense probably benign 0.07
R6965:Rundc1 UTSW 11 101433911 missense possibly damaging 0.96
R7240:Rundc1 UTSW 11 101431548 critical splice donor site probably null
R7286:Rundc1 UTSW 11 101429587 missense probably benign 0.00
R7624:Rundc1 UTSW 11 101433479 missense possibly damaging 0.88
R8243:Rundc1 UTSW 11 101425558 missense probably benign 0.00
R8322:Rundc1 UTSW 11 101432166 missense probably benign 0.01
R8401:Rundc1 UTSW 11 101433557 missense probably damaging 0.99
Z1176:Rundc1 UTSW 11 101432122 missense probably benign 0.00
Z1176:Rundc1 UTSW 11 101433734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATTAAAGTCCCGAGGGG -3'
(R):5'- AGGCAAAGTCTTCGAGCTCG -3'

Sequencing Primer
(F):5'- TTTCCGGGAAGATGGCGAC -3'
(R):5'- AGTCTTCGAGCTCGCGCAG -3'
Posted On2014-10-30