Incidental Mutation 'R2323:Anks3'
ID244820
Institutional Source Beutler Lab
Gene Symbol Anks3
Ensembl Gene ENSMUSG00000022515
Gene Nameankyrin repeat and sterile alpha motif domain containing 3
Synonyms2700067D09Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4941436-4964205 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 4950770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023157] [ENSMUST00000229017] [ENSMUST00000229765]
Predicted Effect probably null
Transcript: ENSMUST00000023157
SMART Domains Protein: ENSMUSP00000023157
Gene: ENSMUSG00000022515

DomainStartEndE-ValueType
ANK 34 64 1.25e2 SMART
ANK 68 97 9.93e-5 SMART
ANK 101 130 9.13e-4 SMART
ANK 134 163 2.45e-4 SMART
ANK 168 197 9.27e-5 SMART
ANK 201 230 5.87e2 SMART
SAM 421 487 9.8e-12 SMART
coiled coil region 500 533 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229017
Predicted Effect probably benign
Transcript: ENSMUST00000229272
Predicted Effect probably null
Transcript: ENSMUST00000229765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230721
Predicted Effect probably benign
Transcript: ENSMUST00000231036
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Anks3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Anks3 APN 16 4953929 missense possibly damaging 0.93
IGL01705:Anks3 APN 16 4947723 missense probably benign 0.00
IGL01953:Anks3 APN 16 4960544 missense probably damaging 1.00
IGL02378:Anks3 APN 16 4950762 missense possibly damaging 0.91
IGL03126:Anks3 APN 16 4958027 missense probably damaging 1.00
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0661:Anks3 UTSW 16 4948334 missense probably damaging 1.00
R0855:Anks3 UTSW 16 4955947 splice site probably benign
R0932:Anks3 UTSW 16 4953827 missense probably damaging 1.00
R1604:Anks3 UTSW 16 4948253 missense probably damaging 0.99
R1773:Anks3 UTSW 16 4947294 missense probably benign
R1846:Anks3 UTSW 16 4953884 missense probably benign 0.07
R1928:Anks3 UTSW 16 4946054 critical splice donor site probably null
R3916:Anks3 UTSW 16 4947279 missense probably damaging 0.97
R5597:Anks3 UTSW 16 4953929 missense possibly damaging 0.93
R5993:Anks3 UTSW 16 4958137 missense probably damaging 1.00
R7345:Anks3 UTSW 16 4955910 missense possibly damaging 0.88
R7373:Anks3 UTSW 16 4955871 missense probably benign 0.00
Z1176:Anks3 UTSW 16 4950714 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AACCGTGGCTCTCACCATAG -3'
(R):5'- CTGGAGAGATGACTCAGTAGC -3'

Sequencing Primer
(F):5'- CATAGGTGGTCTGAGTCTTCCC -3'
(R):5'- TACACAGACACATGGCCT -3'
Posted On2014-10-30