Incidental Mutation 'R2323:Vmn1r234'
ID244824
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21229703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 293 (I293T)
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably benign
Transcript: ENSMUST00000079633
AA Change: I293T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203
AA Change: I293T

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7482:Vmn1r234 UTSW 17 21229375 missense probably benign 0.07
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
R8295:Vmn1r234 UTSW 17 21228839 missense probably benign 0.01
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGCTCCAGTGGTTCCATGG -3'
(R):5'- GAATACAAACATTTCTCTGAGCATG -3'

Sequencing Primer
(F):5'- ATGGTTCTCATTTTGCACAGGCAC -3'
(R):5'- TCTCTGAGCATGATAATTAATGTCAG -3'
Posted On2014-10-30