Incidental Mutation 'R2323:Crebrf'
ID244825
Institutional Source Beutler Lab
Gene Symbol Crebrf
Ensembl Gene ENSMUSG00000048249
Gene NameCREB3 regulatory factor
SynonymsA930001N09Rik
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26715650-26776635 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 26763607 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062519] [ENSMUST00000142539] [ENSMUST00000151681]
Predicted Effect probably benign
Transcript: ENSMUST00000062519
SMART Domains Protein: ENSMUSP00000059102
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
low complexity region 356 407 N/A INTRINSIC
Blast:BRLZ 520 584 3e-35 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000142539
AA Change: Y648H
SMART Domains Protein: ENSMUSP00000114274
Gene: ENSMUSG00000048249
AA Change: Y648H

DomainStartEndE-ValueType
low complexity region 309 322 N/A INTRINSIC
low complexity region 348 399 N/A INTRINSIC
Blast:BRLZ 512 576 3e-35 BLAST
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151681
SMART Domains Protein: ENSMUSP00000119186
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
Blast:BRLZ 100 137 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired social recognition, increased vertical and horizontal activity, abnormal maternal nurturing, decreased prolactin and corticosterone serum levels, and abnormal mammary gland growth during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Hmox2 A T 16: 4,765,856 K263* probably null Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Crebrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Crebrf APN 17 26743093 missense probably damaging 1.00
IGL03106:Crebrf APN 17 26771319 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0254:Crebrf UTSW 17 26739594 missense probably benign 0.01
R0448:Crebrf UTSW 17 26743102 missense probably benign 0.42
R1268:Crebrf UTSW 17 26739596 frame shift probably null
R1857:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1858:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1937:Crebrf UTSW 17 26742468 missense probably damaging 1.00
R2005:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2006:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2031:Crebrf UTSW 17 26742921 missense probably damaging 0.97
R2352:Crebrf UTSW 17 26742346 missense probably damaging 1.00
R4510:Crebrf UTSW 17 26742964 missense probably benign
R4511:Crebrf UTSW 17 26742964 missense probably benign
R4585:Crebrf UTSW 17 26762255 missense probably damaging 1.00
R4642:Crebrf UTSW 17 26743061 missense probably benign 0.23
R4896:Crebrf UTSW 17 26742420 missense possibly damaging 0.75
R5227:Crebrf UTSW 17 26759765 missense probably damaging 1.00
R5377:Crebrf UTSW 17 26759865 missense probably damaging 0.99
R5443:Crebrf UTSW 17 26742354 missense probably damaging 1.00
R5540:Crebrf UTSW 17 26742097 missense possibly damaging 0.90
R6017:Crebrf UTSW 17 26757849 missense probably benign 0.04
R6132:Crebrf UTSW 17 26763403 missense probably benign 0.03
R7464:Crebrf UTSW 17 26763487 missense unknown
Predicted Primers PCR Primer
(F):5'- AACCGAGTTCAGAATCCAAGAG -3'
(R):5'- TGTGATCTAACAGGTGACTTGCTC -3'

Sequencing Primer
(F):5'- GGGCAGAAGCTTGAAATCCTC -3'
(R):5'- ACAGGTGACTTGCTCTTACTGCAG -3'
Posted On2014-10-30