Mutagenetix > Incidental Mutation

Incidental Mutation 'R2323:Tnfrsf21'

244828

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

040314-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R2323 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 43085529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 568 (S568*)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably null
Transcript: ENSMUST00000024708
AA Change: S568*

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: S568*

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	T	A	5: 90,584,852	Y507*	probably null	Het
Abca2	G	T	2: 25,445,175	M2008I	probably benign	Het
Adgrv1	A	G	13: 81,595,179	S68P	probably damaging	Het
Anks3	T	C	16: 4,950,770		probably null	Het
Asap2	T	C	12: 21,203,968	I160T	probably damaging	Het
Asb15	T	A	6: 24,556,601	F32I	probably benign	Het
Catip	A	T	1: 74,363,278	M103L	probably benign	Het
Cela2a	G	C	4: 141,826,079		probably benign	Het
Crebrf	T	C	17: 26,763,607		probably benign	Het
Dnah10	T	C	5: 124,742,000	M450T	probably damaging	Het
Dst	T	C	1: 34,228,437	S5165P	possibly damaging	Het
Esrp2	T	A	8: 106,134,302	D196V	probably benign	Het
Hmox2	A	T	16: 4,765,856	K263*	probably null	Het
Ints10	A	G	8: 68,819,345	H566R	probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Liph	A	G	16: 21,984,004	V105A	probably damaging	Het
Myo1e	T	A	9: 70,378,758	Y941*	probably null	Het
Myo7b	T	C	18: 31,971,345	E1450G	probably damaging	Het
Myt1	G	T	2: 181,806,557	A594S	probably damaging	Het
Npas3	T	A	12: 54,068,346	Y666N	probably damaging	Het
Npsr1	A	G	9: 24,300,436	K240E	probably damaging	Het
Olfr652	T	C	7: 104,564,619	F133L	probably benign	Het
Rtkn2	A	G	10: 68,001,934	I102M	probably damaging	Het
Rundc1	T	C	11: 101,425,275	F58L	probably damaging	Het
Snrpc	T	G	17: 27,847,974	M91R	unknown	Het
Tgfbr2	T	C	9: 116,110,144	K205R	possibly damaging	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tulp1	C	T	17: 28,362,482	G239D	probably damaging	Het
Vmn1r234	T	C	17: 21,229,703	I293T	probably benign	Het
Vmn1r26	T	C	6: 58,008,857	K116E	probably damaging	Het
Vmn2r98	T	A	17: 19,065,819	I193K	probably benign	Het
Wnk4	T	A	11: 101,268,481	S575T	probably damaging	Het
Zfp558	A	T	9: 18,469,277		probably null	Het
Zscan18	T	C	7: 12,775,459		probably benign	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R8991:Tnfrsf21	UTSW	17	43085408	missense	probably benign	0.03
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
R9220:Tnfrsf21	UTSW	17	43087910	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACTGGCTCTCCCCATGAG -3'
(R):5'- GGCCTGTATCAAAGCTGGTTCTG -3'

Sequencing Primer
(F):5'- ATGAGCCCCAGTCCGCTTAG -3'
(R):5'- GGGCACAGTTGTAAAGACTTTC -3'

Posted On

2014-10-30