Incidental Mutation 'R2324:Efcab8'
ID244833
Institutional Source Beutler Lab
Gene Symbol Efcab8
Ensembl Gene ENSMUSG00000044083
Gene NameEF-hand calcium binding domain 8
SynonymsEG329541
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153779931-153844751 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 153783809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126656] [ENSMUST00000144827] [ENSMUST00000230058]
Predicted Effect probably null
Transcript: ENSMUST00000126656
Predicted Effect probably benign
Transcript: ENSMUST00000144827
SMART Domains Protein: ENSMUSP00000135811
Gene: ENSMUSG00000044083

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
SCOP:d1mr8a_ 104 184 5e-7 SMART
Blast:EFh 155 178 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000230058
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Efcab8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1709:Efcab8 UTSW 2 153814370 splice site probably null
R4002:Efcab8 UTSW 2 153781806 missense probably benign 0.20
R5208:Efcab8 UTSW 2 153802423 nonsense probably null
R5393:Efcab8 UTSW 2 153780983 missense unknown
R5411:Efcab8 UTSW 2 153783756 missense probably damaging 0.96
R5766:Efcab8 UTSW 2 153780992 missense possibly damaging 0.90
R6255:Efcab8 UTSW 2 153810268 missense possibly damaging 0.87
R6266:Efcab8 UTSW 2 153783768 missense probably damaging 1.00
R6714:Efcab8 UTSW 2 153789210 missense probably damaging 0.99
R6740:Efcab8 UTSW 2 153804894 missense probably damaging 1.00
R7706:Efcab8 UTSW 2 153781775 missense
R7719:Efcab8 UTSW 2 153787745 missense
R7765:Efcab8 UTSW 2 153843190 missense
R7822:Efcab8 UTSW 2 153810912 missense unknown
Z1177:Efcab8 UTSW 2 153798680 missense probably null
Predicted Primers PCR Primer
(F):5'- CATATTTGTCCCAGATGGCCC -3'
(R):5'- CACACCAAAATGCTGCATGG -3'

Sequencing Primer
(F):5'- CAACCAGGTGGATCCCAGAAG -3'
(R):5'- ACACTTGGGTATCTGGACTAGCAG -3'
Posted On2014-10-30